ID: 1110737700

View in Genome Browser
Species Human (GRCh38)
Location 13:78957162-78957184
Sequence CTAATTAGGTCATGTTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110737700_1110737706 24 Left 1110737700 13:78957162-78957184 CCTGCCAAACATGACCTAATTAG No data
Right 1110737706 13:78957209-78957231 GCCCAAAGCAGAGAAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110737700 Original CRISPR CTAATTAGGTCATGTTTGGC AGG (reversed) Intergenic
No off target data available for this crispr