ID: 1110739449

View in Genome Browser
Species Human (GRCh38)
Location 13:78977399-78977421
Sequence CTAAACCATCACTTAGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110739449_1110739453 11 Left 1110739449 13:78977399-78977421 CCCATGACTAAGTGATGGTTTAG No data
Right 1110739453 13:78977433-78977455 TTAGATGCCGCCTATACGTAGGG No data
1110739449_1110739452 10 Left 1110739449 13:78977399-78977421 CCCATGACTAAGTGATGGTTTAG No data
Right 1110739452 13:78977432-78977454 GTTAGATGCCGCCTATACGTAGG No data
1110739449_1110739454 12 Left 1110739449 13:78977399-78977421 CCCATGACTAAGTGATGGTTTAG No data
Right 1110739454 13:78977434-78977456 TAGATGCCGCCTATACGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110739449 Original CRISPR CTAAACCATCACTTAGTCAT GGG (reversed) Intergenic