ID: 1110740255

View in Genome Browser
Species Human (GRCh38)
Location 13:78987016-78987038
Sequence AAGGGCCAATTGAGCTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110740255_1110740260 5 Left 1110740255 13:78987016-78987038 CCTATAGAGCTCAATTGGCCCTT No data
Right 1110740260 13:78987044-78987066 CACCTGCCCGAACAGCATCCGGG No data
1110740255_1110740259 4 Left 1110740255 13:78987016-78987038 CCTATAGAGCTCAATTGGCCCTT No data
Right 1110740259 13:78987043-78987065 GCACCTGCCCGAACAGCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110740255 Original CRISPR AAGGGCCAATTGAGCTCTAT AGG (reversed) Intergenic
No off target data available for this crispr