ID: 1110750103

View in Genome Browser
Species Human (GRCh38)
Location 13:79103569-79103591
Sequence AACTGCTATCCCTGTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110750097_1110750103 10 Left 1110750097 13:79103536-79103558 CCAACCTTATACTTTGCACGGTT No data
Right 1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG No data
1110750098_1110750103 6 Left 1110750098 13:79103540-79103562 CCTTATACTTTGCACGGTTATGG No data
Right 1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110750103 Original CRISPR AACTGCTATCCCTGTGGTGT TGG Intergenic
No off target data available for this crispr