ID: 1110751653

View in Genome Browser
Species Human (GRCh38)
Location 13:79121972-79121994
Sequence GGTGTGAGGGTGGTAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110751653_1110751661 2 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751661 13:79121997-79122019 TCCAGAGTGAGGCTATTGTGGGG No data
1110751653_1110751660 1 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG No data
1110751653_1110751659 0 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751659 13:79121995-79122017 GCTCCAGAGTGAGGCTATTGTGG No data
1110751653_1110751657 -9 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751657 13:79121986-79122008 CCTCACACCGCTCCAGAGTGAGG No data
1110751653_1110751663 3 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751663 13:79121998-79122020 CCAGAGTGAGGCTATTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110751653 Original CRISPR GGTGTGAGGGTGGTAAATAA AGG (reversed) Intergenic
No off target data available for this crispr