ID: 1110751660

View in Genome Browser
Species Human (GRCh38)
Location 13:79121996-79122018
Sequence CTCCAGAGTGAGGCTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110751652_1110751660 18 Left 1110751652 13:79121955-79121977 CCTGCTGCTGCTTCTCACCTTTA No data
Right 1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG No data
1110751654_1110751660 -9 Left 1110751654 13:79121982-79122004 CCACCCTCACACCGCTCCAGAGT No data
Right 1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG No data
1110751653_1110751660 1 Left 1110751653 13:79121972-79121994 CCTTTATTTACCACCCTCACACC No data
Right 1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG No data
1110751651_1110751660 26 Left 1110751651 13:79121947-79121969 CCTAAAGGCCTGCTGCTGCTTCT No data
Right 1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110751660 Original CRISPR CTCCAGAGTGAGGCTATTGT GGG Intergenic
No off target data available for this crispr