ID: 1110753168

View in Genome Browser
Species Human (GRCh38)
Location 13:79139591-79139613
Sequence ACCCTCCTGCTGTAATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110753168_1110753171 -1 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753171 13:79139613-79139635 TGAGGAGAAAATGGTACATTAGG No data
1110753168_1110753170 -10 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data
1110753168_1110753172 23 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753172 13:79139637-79139659 TTGATCTTTTGATCTAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110753168 Original CRISPR ACCCTCCTGCTGTAATAAAG TGG (reversed) Intergenic
No off target data available for this crispr