ID: 1110753170

View in Genome Browser
Species Human (GRCh38)
Location 13:79139604-79139626
Sequence GCAGGAGGGTGAGGAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110753162_1110753170 7 Left 1110753162 13:79139574-79139596 CCCCTGGAGAACTGCAGCCACTT No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data
1110753164_1110753170 5 Left 1110753164 13:79139576-79139598 CCTGGAGAACTGCAGCCACTTTA No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data
1110753163_1110753170 6 Left 1110753163 13:79139575-79139597 CCCTGGAGAACTGCAGCCACTTT No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data
1110753160_1110753170 25 Left 1110753160 13:79139556-79139578 CCTAGGATTTTGAGTTGTCCCCT No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data
1110753168_1110753170 -10 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753170 13:79139604-79139626 GCAGGAGGGTGAGGAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110753170 Original CRISPR GCAGGAGGGTGAGGAGAAAA TGG Intergenic
No off target data available for this crispr