ID: 1110753171

View in Genome Browser
Species Human (GRCh38)
Location 13:79139613-79139635
Sequence TGAGGAGAAAATGGTACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110753164_1110753171 14 Left 1110753164 13:79139576-79139598 CCTGGAGAACTGCAGCCACTTTA No data
Right 1110753171 13:79139613-79139635 TGAGGAGAAAATGGTACATTAGG No data
1110753168_1110753171 -1 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753171 13:79139613-79139635 TGAGGAGAAAATGGTACATTAGG No data
1110753162_1110753171 16 Left 1110753162 13:79139574-79139596 CCCCTGGAGAACTGCAGCCACTT No data
Right 1110753171 13:79139613-79139635 TGAGGAGAAAATGGTACATTAGG No data
1110753163_1110753171 15 Left 1110753163 13:79139575-79139597 CCCTGGAGAACTGCAGCCACTTT No data
Right 1110753171 13:79139613-79139635 TGAGGAGAAAATGGTACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110753171 Original CRISPR TGAGGAGAAAATGGTACATT AGG Intergenic
No off target data available for this crispr