ID: 1110753172

View in Genome Browser
Species Human (GRCh38)
Location 13:79139637-79139659
Sequence TTGATCTTTTGATCTAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110753168_1110753172 23 Left 1110753168 13:79139591-79139613 CCACTTTATTACAGCAGGAGGGT No data
Right 1110753172 13:79139637-79139659 TTGATCTTTTGATCTAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110753172 Original CRISPR TTGATCTTTTGATCTAATTG TGG Intergenic
No off target data available for this crispr