ID: 1110756875

View in Genome Browser
Species Human (GRCh38)
Location 13:79185001-79185023
Sequence GCCTATAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 855615
Summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756875_1110756882 28 Left 1110756875 13:79185001-79185023 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756875_1110756877 -1 Left 1110756875 13:79185001-79185023 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756875 Original CRISPR GCCTATAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr