ID: 1110756876

View in Genome Browser
Species Human (GRCh38)
Location 13:79185002-79185024
Sequence CGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 807629
Summary {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756876_1110756877 -2 Left 1110756876 13:79185002-79185024 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756876_1110756882 27 Left 1110756876 13:79185002-79185024 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756876 Original CRISPR CGCCTATAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr