ID: 1110756877

View in Genome Browser
Species Human (GRCh38)
Location 13:79185023-79185045
Sequence CGAGCCACCACACCCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756873_1110756877 2 Left 1110756873 13:79184998-79185020 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756869_1110756877 11 Left 1110756869 13:79184989-79185011 CCACCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756875_1110756877 -1 Left 1110756875 13:79185001-79185023 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756871_1110756877 8 Left 1110756871 13:79184992-79185014 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756868_1110756877 15 Left 1110756868 13:79184985-79185007 CCGACCACCTCAGCCTCCCAAAG 0: 189
1: 25583
2: 80340
3: 166266
4: 178871
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756867_1110756877 24 Left 1110756867 13:79184976-79184998 CCTCATGATCCGACCACCTCAGC 0: 4
1: 823
2: 6198
3: 22957
4: 56153
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data
1110756876_1110756877 -2 Left 1110756876 13:79185002-79185024 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1110756877 13:79185023-79185045 CGAGCCACCACACCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756877 Original CRISPR CGAGCCACCACACCCAGCAG AGG Intergenic
No off target data available for this crispr