ID: 1110756879

View in Genome Browser
Species Human (GRCh38)
Location 13:79185030-79185052
Sequence GAAACTACCTCTGCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756879_1110756882 -1 Left 1110756879 13:79185030-79185052 CCACACCCAGCAGAGGTAGTTTC No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756879 Original CRISPR GAAACTACCTCTGCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr