ID: 1110756880

View in Genome Browser
Species Human (GRCh38)
Location 13:79185035-79185057
Sequence TTTAAGAAACTACCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756880_1110756882 -6 Left 1110756880 13:79185035-79185057 CCCAGCAGAGGTAGTTTCTTAAA No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756880 Original CRISPR TTTAAGAAACTACCTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr