ID: 1110756882

View in Genome Browser
Species Human (GRCh38)
Location 13:79185052-79185074
Sequence CTTAAAAGCTAGTTGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110756876_1110756882 27 Left 1110756876 13:79185002-79185024 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756875_1110756882 28 Left 1110756875 13:79185001-79185023 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756879_1110756882 -1 Left 1110756879 13:79185030-79185052 CCACACCCAGCAGAGGTAGTTTC No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756878_1110756882 2 Left 1110756878 13:79185027-79185049 CCACCACACCCAGCAGAGGTAGT No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756881_1110756882 -7 Left 1110756881 13:79185036-79185058 CCAGCAGAGGTAGTTTCTTAAAA No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data
1110756880_1110756882 -6 Left 1110756880 13:79185035-79185057 CCCAGCAGAGGTAGTTTCTTAAA No data
Right 1110756882 13:79185052-79185074 CTTAAAAGCTAGTTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110756882 Original CRISPR CTTAAAAGCTAGTTGTAATG TGG Intergenic
No off target data available for this crispr