ID: 1110759419

View in Genome Browser
Species Human (GRCh38)
Location 13:79214782-79214804
Sequence GTGCCACTACACCCGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110759409_1110759419 19 Left 1110759409 13:79214740-79214762 CCTCCTGAATCAGCCTCCCCAAG No data
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data
1110759412_1110759419 6 Left 1110759412 13:79214753-79214775 CCTCCCCAAGTAGCTGGAACTAC 0: 11
1: 227
2: 1274
3: 3565
4: 5286
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data
1110759415_1110759419 2 Left 1110759415 13:79214757-79214779 CCCAAGTAGCTGGAACTACAGGT 0: 781
1: 18710
2: 106292
3: 247320
4: 259681
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data
1110759410_1110759419 16 Left 1110759410 13:79214743-79214765 CCTGAATCAGCCTCCCCAAGTAG No data
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data
1110759416_1110759419 1 Left 1110759416 13:79214758-79214780 CCAAGTAGCTGGAACTACAGGTG 0: 1260
1: 32038
2: 106849
3: 133259
4: 151394
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data
1110759413_1110759419 3 Left 1110759413 13:79214756-79214778 CCCCAAGTAGCTGGAACTACAGG 0: 94
1: 1551
2: 4261
3: 7050
4: 7653
Right 1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110759419 Original CRISPR GTGCCACTACACCCGGGTGA TGG Intergenic
No off target data available for this crispr