ID: 1110762523

View in Genome Browser
Species Human (GRCh38)
Location 13:79246006-79246028
Sequence TGAGAATACCTGTGAATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110762523_1110762525 19 Left 1110762523 13:79246006-79246028 CCAGATATTCACAGGTATTCTCA No data
Right 1110762525 13:79246048-79246070 GCTGAGAGTAGCAAGCCAGATGG No data
1110762523_1110762524 -6 Left 1110762523 13:79246006-79246028 CCAGATATTCACAGGTATTCTCA No data
Right 1110762524 13:79246023-79246045 TTCTCAGTGAGAGAGTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110762523 Original CRISPR TGAGAATACCTGTGAATATC TGG (reversed) Intergenic
No off target data available for this crispr