ID: 1110763247

View in Genome Browser
Species Human (GRCh38)
Location 13:79253429-79253451
Sequence AGCTGTGTGTGGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110763247_1110763256 27 Left 1110763247 13:79253429-79253451 CCTTCTTTCCTCCACACACAGCT No data
Right 1110763256 13:79253479-79253501 TGTATATTTTAAGATACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110763247 Original CRISPR AGCTGTGTGTGGAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr