ID: 1110767260

View in Genome Browser
Species Human (GRCh38)
Location 13:79295071-79295093
Sequence CTAGTTTGCCAACAATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110767256_1110767260 9 Left 1110767256 13:79295039-79295061 CCTCTTCAGAGACCAGGGGTACT No data
Right 1110767260 13:79295071-79295093 CTAGTTTGCCAACAATCCCTGGG No data
1110767252_1110767260 21 Left 1110767252 13:79295027-79295049 CCAGTAGACGTGCCTCTTCAGAG No data
Right 1110767260 13:79295071-79295093 CTAGTTTGCCAACAATCCCTGGG No data
1110767257_1110767260 -3 Left 1110767257 13:79295051-79295073 CCAGGGGTACTAGAGCAATCCTA No data
Right 1110767260 13:79295071-79295093 CTAGTTTGCCAACAATCCCTGGG No data
1110767251_1110767260 22 Left 1110767251 13:79295026-79295048 CCCAGTAGACGTGCCTCTTCAGA No data
Right 1110767260 13:79295071-79295093 CTAGTTTGCCAACAATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110767260 Original CRISPR CTAGTTTGCCAACAATCCCT GGG Intergenic
No off target data available for this crispr