ID: 1110780205

View in Genome Browser
Species Human (GRCh38)
Location 13:79456477-79456499
Sequence GTTTATGGGAGAGAATGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110780205_1110780209 -5 Left 1110780205 13:79456477-79456499 CCTAAACATTCTCTCCCATAAAC No data
Right 1110780209 13:79456495-79456517 TAAACCAGGAGCTACAAAGATGG No data
1110780205_1110780210 -4 Left 1110780205 13:79456477-79456499 CCTAAACATTCTCTCCCATAAAC No data
Right 1110780210 13:79456496-79456518 AAACCAGGAGCTACAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110780205 Original CRISPR GTTTATGGGAGAGAATGTTT AGG (reversed) Intergenic
No off target data available for this crispr