ID: 1110780209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:79456495-79456517 |
| Sequence | TAAACCAGGAGCTACAAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1110780205_1110780209 | -5 | Left | 1110780205 | 13:79456477-79456499 | CCTAAACATTCTCTCCCATAAAC | No data | ||
| Right | 1110780209 | 13:79456495-79456517 | TAAACCAGGAGCTACAAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1110780209 | Original CRISPR | TAAACCAGGAGCTACAAAGA TGG | Intergenic | ||