ID: 1110782537

View in Genome Browser
Species Human (GRCh38)
Location 13:79482280-79482302
Sequence CAAAGTTTACACAGTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110782537 Original CRISPR CAAAGTTTACACAGTTAAGC TGG (reversed) Intronic
902825783 1:18973257-18973279 CAAAGTTCACACACTTTAGCAGG + Intergenic
908386931 1:63651777-63651799 CAAAGTTTACACTGTGGAGAAGG + Exonic
909111801 1:71488454-71488476 CAAACTTGAAACAGTTCAGCTGG - Intronic
909246410 1:73290866-73290888 CAAAGTTTAAAATGATAAGCTGG - Intergenic
910955988 1:92705537-92705559 CTAGGTTTACACTGTTAAACTGG + Intronic
913347089 1:117819831-117819853 CCAAGTTTGCATAGTAAAGCTGG - Intergenic
915267442 1:154729102-154729124 CAAAGATTCCACAGTTAGCCAGG - Intronic
916415891 1:164591512-164591534 AAAAGTTTACTCTCTTAAGCAGG - Intronic
916446236 1:164874788-164874810 TAAAAATTACACAGTAAAGCTGG - Intronic
917738212 1:177939176-177939198 GAAAGGGTACACAGTTAACCAGG + Intronic
918142170 1:181728508-181728530 CAGAGTGTACACAGCTGAGCGGG - Intronic
919790324 1:201286326-201286348 CAAAGTTTCCCTAGTTAAGAAGG + Intronic
920614168 1:207472966-207472988 GAAAGTTTACACAGGGGAGCAGG - Exonic
924403980 1:243722091-243722113 TAAAATTTACACAGCTTAGCAGG + Intronic
1065629531 10:27663705-27663727 TAAAGTTTACTCACTTAACCAGG - Intergenic
1069227681 10:65964033-65964055 CAAAGTTTACTAAATAAAGCTGG - Intronic
1074350562 10:112732906-112732928 CAGAGTTGACACAGTAAAGGTGG + Intronic
1079305792 11:19320542-19320564 CAATGTTTATACAGTTTAGCGGG + Intergenic
1080322537 11:31029976-31029998 CATAATATACACAGTTAAACTGG + Intronic
1081974122 11:47220543-47220565 GAAAGTTTACACTGTAAAGAAGG - Intronic
1082642367 11:55679110-55679132 CAAAGACCACACAGTTAGGCAGG - Intergenic
1084107563 11:66989757-66989779 CAAAGCTTCCACAGTGCAGCAGG - Intergenic
1085099474 11:73788303-73788325 CCAAGGTCACACAGTTAATCGGG - Intronic
1087396725 11:97609810-97609832 CAAAGATTACAGAGATAAGAAGG + Intergenic
1088029463 11:105228665-105228687 TAAAGTTTACACAGCTAGGTGGG + Intergenic
1089985061 11:122804904-122804926 GAAACTCTACATAGTTAAGCGGG + Intronic
1091910988 12:4230569-4230591 CACAGTCTACACAAATAAGCAGG - Intergenic
1092499161 12:9028771-9028793 CATATTTTTCACAGTTAAGTGGG + Intergenic
1094129971 12:27064290-27064312 CAAGGTTTACACACTTCACCTGG - Intronic
1098228175 12:68346067-68346089 CCAAGTTTATACAGTTAAATTGG - Intergenic
1099137215 12:78920850-78920872 CAAAGATTAGACAGATTAGCAGG + Intronic
1099168064 12:79331049-79331071 AACAGGTTACAGAGTTAAGCTGG - Intronic
1099664261 12:85607198-85607220 TAAAGTTTCCAAAGTTAAACAGG - Intergenic
1105380830 13:19885684-19885706 CAAAATTTACAAAATTTAGCTGG + Intergenic
1106434825 13:29714217-29714239 CAAAGTTAACACTGATCAGCAGG - Intergenic
1106501046 13:30329314-30329336 CTAAGTTTAAAAAGTTAAACAGG - Intergenic
1108608118 13:52060640-52060662 AAATGTTTACAAAGTTAGGCTGG - Intronic
1110497987 13:76190974-76190996 CAAAGTTTCCACAGTGCAGAAGG - Intergenic
1110782537 13:79482280-79482302 CAAAGTTTACACAGTTAAGCTGG - Intronic
1111582602 13:90243658-90243680 CACAGCTTACACACTTAACCCGG - Intergenic
1114949383 14:27729511-27729533 CAAAGGTGACAAAGTGAAGCTGG + Intergenic
1115712154 14:36062359-36062381 CTAAGTTTACCCAGTTAACCTGG - Intergenic
1118116699 14:62785894-62785916 AAAAATTTCCACAGTTAGGCAGG + Intronic
1118359127 14:65041294-65041316 AAATGTTTACACAGTGCAGCAGG - Intronic
1120095024 14:80378809-80378831 GAAAGTGTGCACAGTTAAACAGG + Intronic
1120167089 14:81212423-81212445 CACAGTTTACACATTAAAGTAGG + Intronic
1120877020 14:89384293-89384315 CAAAGTGAGCACAGTGAAGCAGG - Intronic
1128439358 15:67689971-67689993 CAAAGTTTACAAATTTGCGCTGG - Intronic
1128655194 15:69455773-69455795 TCAAGTTTACACAGGTAACCTGG - Exonic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1132330527 15:101009262-101009284 CCAAGTTTACACAGCTCACCCGG + Intronic
1136157627 16:28394716-28394738 CAGAGTTTACACAGAAAAACGGG + Intronic
1136205460 16:28720568-28720590 CAGAGTTTACACAGAAAAACGGG - Intronic
1137233887 16:46596712-46596734 AAAAGTTTACTCATTTAGGCTGG - Intronic
1138134606 16:54510867-54510889 CAAAGTTTAGTCAGTGTAGCAGG - Intergenic
1138730607 16:59189901-59189923 CAAAGTGTCCACAGATAAACTGG - Intergenic
1141578839 16:84983394-84983416 CAAATTTTAGAAAGTTCAGCAGG + Intronic
1142722798 17:1788055-1788077 CAAACTTTATATATTTAAGCAGG + Intronic
1144267434 17:13584850-13584872 CAAAGATTACACAGATACACTGG + Intronic
1144436679 17:15248788-15248810 CTAAGTTTTGAAAGTTAAGCAGG - Intronic
1146248820 17:31318128-31318150 CACAGTTTAAATAATTAAGCAGG + Exonic
1147785343 17:42974429-42974451 CAAAGTTTCCACATTTATACAGG + Intronic
1149476191 17:56962923-56962945 CAAAGATTACAAAATTTAGCAGG - Intergenic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1153090994 18:1342636-1342658 CAAAGCTTATACAGAAAAGCTGG + Intergenic
1153124500 18:1774628-1774650 CAAAGTTTACACAGTTGGCTGGG + Intergenic
1155638657 18:27985854-27985876 CCAAGGTTACACAGTTAAAAGGG - Intronic
1157128964 18:44984842-44984864 CAAAGTTTACATGCTTAGGCCGG + Intronic
1158883189 18:61800669-61800691 AAAAGTTTACACCTTCAAGCTGG + Intergenic
1160854067 19:1208071-1208093 CAAAGTTTTGAAAGTTAAGAAGG - Intronic
1161365822 19:3878985-3879007 CAAAAATTACACAGATTAGCAGG + Intergenic
1163443635 19:17334206-17334228 CCAAGGTCACACAGTCAAGCTGG + Intronic
1164321676 19:24153699-24153721 GAAAGTTTACACAGCTGAGGCGG - Intergenic
1167236080 19:48316395-48316417 CACAGTTTGCACAGTTAGGCAGG - Intronic
925633692 2:5921737-5921759 GAAAGTTTTCACAATTAAACAGG - Intergenic
927896406 2:26785518-26785540 CAAAGTTTATGCAGTTGAACTGG + Intronic
928051977 2:28008481-28008503 CAAAGCATACACACTTCAGCAGG - Intronic
928274418 2:29886890-29886912 CATGGTTTACACAGTAAAGAAGG + Intronic
931686925 2:64801780-64801802 CACAGTTTGCACAGCTGAGCTGG + Intergenic
932638688 2:73418521-73418543 AAATTTTTACACAGTTGAGCCGG - Intronic
932716948 2:74107758-74107780 CACAGTTTACAAAGTCAAGACGG - Exonic
932869974 2:75389028-75389050 CCAAGGGTACACAGTAAAGCCGG - Intergenic
933987569 2:87604576-87604598 CAAAATGTACACAGTGAAACCGG - Intergenic
935060218 2:99600929-99600951 CAAAGAAAACACAGTTAAGAAGG + Intronic
936067972 2:109346551-109346573 CAAAGCTCCCACAGTTGAGCAGG + Intronic
936306271 2:111346232-111346254 CAAAATGTACACAGTGAAACCGG + Intergenic
938653709 2:133409589-133409611 AGAAGTTTACAGAGTTGAGCAGG + Intronic
938659775 2:133473645-133473667 CAACGTTTACAAAGTAAGGCTGG - Intronic
940762327 2:157751407-157751429 GAATTTTTACACAGTTCAGCTGG - Intronic
941367672 2:164626884-164626906 AAAAGTCAACACAGTTAGGCCGG - Intergenic
941866131 2:170336724-170336746 CAAATTTTACAAAGGTAAACTGG - Intronic
943955783 2:194187677-194187699 TATCTTTTACACAGTTAAGCGGG - Intergenic
946500410 2:220241321-220241343 CACAGTTTAGAGAGCTAAGCTGG - Intergenic
1169463863 20:5820649-5820671 CAAAGTTCACAAAGTGAAGAAGG + Intronic
1169464284 20:5823769-5823791 GAAAGTTTACACAGTTGTGTTGG + Intronic
1169983780 20:11419197-11419219 AAAAGTTCACACAGTTAAGAGGG - Intergenic
1172669975 20:36628280-36628302 AAAAGTTTACACTGTGACGCAGG + Intronic
1173951974 20:47000660-47000682 AAAAGGTGACAGAGTTAAGCTGG - Intronic
1182600279 22:31457590-31457612 CACAGTTTCCAAAGTTAAGCAGG + Intronic
1184243854 22:43226173-43226195 TAAGCTTTACACAGTTAAACAGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952577206 3:34789838-34789860 CAAACTTTATACAATTAATCAGG + Intergenic
955956585 3:64295995-64296017 AAAAGTTTACACACTTCAGCAGG + Intronic
956028067 3:65005223-65005245 GAAAGTATACTCAGGTAAGCTGG - Intergenic
957698112 3:83670242-83670264 CAAAGATTACACAGTCATGCAGG + Intergenic
959396170 3:105841333-105841355 CAAAGTTTCCACAGTTGTTCTGG + Intronic
961615792 3:128179788-128179810 CAAAATTTAGCCAGTTCAGCAGG + Intronic
962123363 3:132587901-132587923 CAAAGTTTCCACATGAAAGCTGG + Intronic
963134026 3:141884176-141884198 CAAAGTTTAAACAGGTATGTGGG - Intronic
963372568 3:144419998-144420020 CAAAATTTACATTGTTAAGTTGG - Intergenic
964544522 3:157819107-157819129 CAAACTTTAAACAGTTTAGCTGG + Intergenic
964673017 3:159247686-159247708 CAGATTTTACACAGAAAAGCAGG + Intronic
965089539 3:164144798-164144820 CAAAGTTTATAAAGTTAAAGAGG + Intergenic
965905490 3:173700348-173700370 CAAAGTTCACACAGATAACAAGG - Intronic
965967009 3:174504532-174504554 CAATGTTTAAACAGTTAGGATGG - Intronic
967562095 3:190927837-190927859 CAAGCTTTACACAGTTATGTAGG - Intergenic
970920354 4:21386931-21386953 CAAAGTTTACACTGTGCAGGAGG - Intronic
971292472 4:25357418-25357440 CAGCTTTTACACAGTTATGCTGG + Intronic
973878388 4:55243563-55243585 CAATGGTTACAAAGTTAAGATGG + Intergenic
976108208 4:81641976-81641998 TACAGTTTAGACAGTTGAGCTGG + Intronic
976145457 4:82038666-82038688 CAAGGATTACACAGGTAAGTGGG + Intronic
978198624 4:105998908-105998930 CATCTTTTACACAGTTATGCAGG - Intronic
979295530 4:119029015-119029037 CAGTTTTTACACAGTTAAGTGGG + Intronic
980564490 4:134521200-134521222 CAAAATTTACACTATTAAACTGG - Intergenic
984262203 4:177455554-177455576 CAGAGTTTCCACTGTGAAGCGGG - Intergenic
986666506 5:10109211-10109233 CAAAGTTTACCAAGTCAAGAAGG + Intergenic
988544958 5:32146940-32146962 CAAAGTTTACAAATTTGTGCTGG + Intronic
989489832 5:42037430-42037452 CAAATTTTATAAAGTTAATCAGG + Intergenic
990045968 5:51431834-51431856 GAAAGTTTGGACAGTTATGCAGG + Intergenic
990249019 5:53893735-53893757 TGAAGGTTACCCAGTTAAGCTGG - Intronic
990310120 5:54529748-54529770 CCAAGGTTACACAGTGAAGCTGG - Intronic
990486456 5:56263847-56263869 CAAAGTTTATACAGTCAAATTGG + Intergenic
994176323 5:96715483-96715505 CTAAGATTACACAGTTAAGAAGG - Intronic
994773456 5:104013333-104013355 CAAAGTTTCCACAGTTTCGAAGG + Intergenic
995378803 5:111509628-111509650 CAAAGATTTTACAGTTAAACGGG - Intronic
996482694 5:123992838-123992860 CAAAGACTACACTGTTAACCAGG + Intergenic
1000087861 5:157904106-157904128 CAGAGTTTAAAAAGTGAAGCCGG + Intergenic
1001369296 5:171181051-171181073 CAAACTTCACTCAGTTAAACTGG - Intronic
1001754231 5:174155663-174155685 CAAAGTTTATACATTGAACCTGG + Intronic
1002327087 5:178416720-178416742 CCAAGGTCACACAGTTAAGTAGG + Intronic
1004996477 6:21198696-21198718 CAAAGCTCTCACAGTGAAGCTGG - Intronic
1006643498 6:35500496-35500518 CAAAGGGCACACAGTTGAGCTGG + Intronic
1009396951 6:63211299-63211321 CAAAGTTAACAAAGTTAACAAGG + Intergenic
1009796209 6:68471573-68471595 CAAAATTTACAAAATTTAGCTGG - Intergenic
1012344980 6:98173749-98173771 CAAAGTATATACAGTTAAGGTGG - Intergenic
1013120155 6:107133918-107133940 CAAAGATTACACAAATTAGCTGG + Intergenic
1013879742 6:114882466-114882488 CAAATTTTAGAAAGTTAACCAGG + Intergenic
1015347770 6:132179984-132180006 AAATGTTTACAAAGTTAAGCTGG - Intergenic
1017502102 6:155035049-155035071 CGAAGCTTTCACAGTTAAGGAGG + Intronic
1019597650 7:1865710-1865732 TTAAGTTTGCACAGTTAATCAGG + Intronic
1023169003 7:37372489-37372511 CTAAGTTCACAAAGTCAAGCAGG + Intronic
1023741170 7:43281983-43282005 GAAAGGAAACACAGTTAAGCTGG - Intronic
1027288525 7:76675999-76676021 CAAAGTTAATACAATTAAGTAGG - Intergenic
1027933632 7:84573225-84573247 CTAAGTTCATAAAGTTAAGCTGG - Intergenic
1028171985 7:87609176-87609198 CAAAGTTTACAATTTTAAGTAGG + Intronic
1029799689 7:102933556-102933578 CCAGGTTGATACAGTTAAGCAGG + Intronic
1030392891 7:108948959-108948981 CAAAGTTTACAAAGATAAAAAGG + Intergenic
1030638054 7:111972200-111972222 GAAAGTTTCCATAGTTAAACAGG - Intronic
1031168375 7:118259758-118259780 CAAAGTTGACAGAGTCAAGAAGG - Intergenic
1031360963 7:120847897-120847919 CAAAGTTTAAACTCTTGAGCAGG + Intronic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1039114291 8:34075128-34075150 CCAAGTTTTCACACTTCAGCAGG - Intergenic
1040946067 8:52885186-52885208 CAAACTTTATAAAGTTAATCAGG - Intergenic
1041693271 8:60711167-60711189 CAATGTTTACACTTTAAAGCTGG - Intronic
1041774173 8:61505879-61505901 CACAGCTTCCACAGTTAGGCAGG + Intronic
1044099597 8:88117370-88117392 CAAAGTTTACACATGTAATTTGG + Intronic
1045837997 8:106546297-106546319 CAAAGTGAGCACAGTTTAGCAGG - Intronic
1047164972 8:122427842-122427864 AAGAGTTAACAAAGTTAAGCAGG + Intergenic
1047901783 8:129431170-129431192 CAAAGTCTACCCAGTTGAGAAGG - Intergenic
1057099382 9:92343647-92343669 TAAGTTTTACAAAGTTAAGCTGG + Intronic
1059263602 9:113004367-113004389 TAAAGTTTAGTCAGTTAAGTTGG - Intergenic
1061963519 9:134000068-134000090 CAAAGTTTCCAGAGTTCGGCAGG - Intergenic
1185686021 X:1929037-1929059 AAAAGTTCACACAGGTATGCCGG - Intergenic
1188317768 X:28695781-28695803 TAGAGTTTACACATGTAAGCTGG + Intronic
1189512532 X:41677393-41677415 CAAGGTCTAGACAGTGAAGCAGG + Intronic
1189861035 X:45272341-45272363 CAAAGTTTGCTCAGTTATGATGG + Intergenic
1192246307 X:69374657-69374679 CCAAGGTTACACAGTAGAGCTGG - Intergenic
1192952341 X:76029850-76029872 CAAAGTTATCATTGTTAAGCTGG + Intergenic
1193230176 X:79034955-79034977 CATAGTTTATACAGTAAAACAGG - Intergenic
1197319793 X:125013808-125013830 CAGAGTTTACACACTTAATCTGG - Intergenic
1199282538 X:146019237-146019259 CAAATCTTACACAATTAAGGAGG - Intergenic
1199819135 X:151427343-151427365 CACAGTCTACACAGTTACCCAGG - Intergenic
1201736764 Y:17271793-17271815 CAAAGAGTAAACTGTTAAGCAGG + Intergenic
1202064018 Y:20918240-20918262 AGAAGTTTCCACAGTTAAGAAGG - Intergenic