ID: 1110785948

View in Genome Browser
Species Human (GRCh38)
Location 13:79526174-79526196
Sequence TTGGATAAGGATGAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 541}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110785944_1110785948 -10 Left 1110785944 13:79526161-79526183 CCTTGGTGACAGATTGGATAAGG 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG 0: 1
1: 0
2: 5
3: 51
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110785948 Original CRISPR TTGGATAAGGATGAGGGAGA AGG Intronic
901214844 1:7549420-7549442 GGGAATAAGGATGAGGGAGGTGG - Intronic
901411643 1:9088342-9088364 GTGGAGAAGGAGGAGGGAGGGGG - Intronic
901648039 1:10727145-10727167 CTGGAGAAGGAAGAGGGAAAAGG + Intronic
901811056 1:11766936-11766958 TTGGAGAAGGCTGAGGAACAGGG - Intronic
902126335 1:14215230-14215252 TTAGATAAGTATGATGTAGAAGG + Intergenic
903467246 1:23560099-23560121 TTGCAGAAGGAGGAGGGAAAGGG + Intergenic
903562734 1:24240646-24240668 TTGGAGAAACATGAGGGAAAAGG + Intergenic
903656827 1:24954671-24954693 TTGGACAAGGACAAGGGCGAAGG - Intronic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
905024693 1:34841629-34841651 TTGGATAGTGCTGAGTGAGAGGG - Intronic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905112482 1:35605961-35605983 GTGGCTAAGGTTGAGCGAGAGGG + Intronic
906395059 1:45455656-45455678 CTGGAAAAGGATAATGGAGATGG + Intronic
906398584 1:45488392-45488414 ATGGATAATGATGTGGTAGAAGG - Intronic
907014999 1:51004080-51004102 TTGGATTAGAACAAGGGAGAGGG - Intergenic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
908364651 1:63408165-63408187 TTGGGAAAGGAGGAGGGAGAAGG - Intronic
908819139 1:68065333-68065355 AGGGTTAAGGATGAGGGAGGAGG + Intergenic
910823795 1:91383479-91383501 TTGATTAAAAATGAGGGAGAGGG - Intronic
911717829 1:101155085-101155107 TTATATGTGGATGAGGGAGAAGG + Intergenic
912159686 1:106966683-106966705 GTGGATAAGGGTGAGAGATAAGG - Intergenic
912304530 1:108553795-108553817 CTGGAGAAGGATGGGGGTGATGG + Intergenic
912551003 1:110485192-110485214 ATGGAAAAGGATCAGGGAGACGG - Intergenic
912936597 1:114008382-114008404 TTGGACAAGGAGGAAGGACATGG + Intergenic
913193644 1:116434161-116434183 CTGGAGAAGCCTGAGGGAGATGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913572655 1:120136364-120136386 TTGGATAAGGAGGACTGAGCAGG - Intergenic
914256361 1:145963186-145963208 TTAGATAAGTATGAGGAAGGTGG + Intronic
914262047 1:146007338-146007360 GTTTATAAGTATGAGGGAGATGG + Intergenic
914293500 1:146297278-146297300 TTGGATAAGGAGGACTGAGCAGG - Intergenic
914554544 1:148748061-148748083 TTGGATAAGGAGGACTGAGCAGG - Intergenic
915248854 1:154574378-154574400 CTGGATTAGGATGAGGGTGGGGG - Intronic
915836269 1:159178372-159178394 TTTGCTAAGGTTGAGGGAAAAGG - Intronic
916635990 1:166669110-166669132 TGGGATAATGATCAGGGAAAGGG - Intergenic
918742878 1:188158342-188158364 TTGGATGAGTAGGTGGGAGAGGG + Intergenic
920294650 1:204948486-204948508 CTGGAGAAGGGTGAGTGAGAGGG - Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920436201 1:205948597-205948619 GTGGAATAGGAAGAGGGAGATGG - Intergenic
920769513 1:208868016-208868038 TTGAATAAGAATTAGGGAGTTGG - Intergenic
921148689 1:212382990-212383012 TTGGAAAAGGAAGAAGGGGAAGG - Intronic
923487123 1:234444019-234444041 TTGGAGATGGATGATGGTGATGG + Intronic
923871448 1:237998557-237998579 TTAGATATGGAGGAGGAAGATGG - Intergenic
923909038 1:238418880-238418902 TGGGATTAGGATGGGGAAGAGGG + Intergenic
924570278 1:245231656-245231678 GTGGTTAAAGATGAGGGAGAAGG + Intronic
924594676 1:245434899-245434921 TTGTACAAGGATGAGGGTGCTGG - Intronic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1063256142 10:4329298-4329320 TTGGAAAAGGTTCAGGGAGCTGG + Intergenic
1063955423 10:11261120-11261142 TTGGATTATGGTGAGGGAGAGGG + Intronic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1064869593 10:19922442-19922464 TGGGATCAGGAGGAAGGAGATGG + Intronic
1065186772 10:23175922-23175944 TTGGCCAAGGATAAGGAAGATGG + Intergenic
1065520236 10:26565136-26565158 TTTGATTAGGATGAAGGAGATGG - Intronic
1065551435 10:26871833-26871855 TTTGATAAGGAGGATTGAGAGGG + Intergenic
1065567700 10:27031524-27031546 TTGGAGAAGGTGGAGGGACATGG + Intronic
1065747417 10:28855009-28855031 AAGGATAAGGAGGAAGGAGACGG - Intronic
1066070196 10:31800776-31800798 AGAGATAAGCATGAGGGAGATGG + Intergenic
1069133272 10:64732258-64732280 TTAGATAGGGATGAGTGAGGCGG + Intergenic
1069441549 10:68433233-68433255 TGGGGAGAGGATGAGGGAGAGGG - Intronic
1069705058 10:70453829-70453851 TTGCCTAGGGATGGGGGAGAGGG + Intergenic
1069783387 10:70970903-70970925 TTGGATCAGGCTGAGGCAGCTGG + Intergenic
1069820225 10:71222958-71222980 TGGGATAGGGATGGGGGAGGGGG - Intronic
1069869179 10:71522799-71522821 TTGGATAGAGAGGAAGGAGAAGG + Intronic
1069998226 10:72356275-72356297 TTGGATAAGGGTGATGGCGGAGG + Intergenic
1070826879 10:79396000-79396022 TGGGATAAGGAAGTGGGAGTAGG - Intronic
1071399072 10:85251726-85251748 TTAGATAAAGATAAGAGAGATGG - Intergenic
1071858415 10:89648452-89648474 TTGGAAGAGAGTGAGGGAGAAGG + Intergenic
1071971913 10:90916105-90916127 GTGGAGAAGGATGGGGGACAGGG + Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073029950 10:100517867-100517889 TTAGAAGAGAATGAGGGAGAAGG - Intronic
1073153648 10:101329273-101329295 TTGGATAAGCAAGAGGGTTAAGG + Intergenic
1073170577 10:101504506-101504528 TGGGATAAGGATGAAGGAAGAGG - Intronic
1074548445 10:114420566-114420588 TTGCTTAAGGCTGAGGGGGATGG - Intergenic
1075249596 10:120854187-120854209 TTGCCAAAGGATGAGGGAAATGG - Intronic
1075287751 10:121201888-121201910 TTGGATAGTGATGAGGGCTATGG - Intergenic
1077392581 11:2306941-2306963 GAGGAGAAGGAGGAGGGAGAAGG + Intronic
1078843756 11:15103412-15103434 TAGAATAAGGATGGTGGAGAGGG - Intergenic
1080806928 11:35662611-35662633 TTGGAGGAGGAGGAGGGAGAAGG - Intergenic
1081662634 11:44897247-44897269 TTGCATAAGGATTTGTGAGAAGG - Intronic
1083091653 11:60206099-60206121 AAGGAAAAGGATGGGGGAGAAGG + Intronic
1083514789 11:63246804-63246826 TTGGAGACAGAGGAGGGAGAAGG - Intronic
1084145211 11:67261606-67261628 GAGGATGAGGATGAGGGCGAGGG + Intergenic
1085640506 11:78189761-78189783 AAGGATAAGGAGGAGAGAGAAGG - Intronic
1086197785 11:84161687-84161709 TTGGATAAGGAAAAAGGAGAAGG + Intronic
1086841909 11:91696277-91696299 CTGGAAAGAGATGAGGGAGATGG + Intergenic
1087023840 11:93630048-93630070 TTGGAAAAAGATGGGAGAGAGGG + Intergenic
1087653216 11:100892217-100892239 ATGGATAATGAATAGGGAGAAGG + Intronic
1087812407 11:102622708-102622730 TTCCATGAGGATGAGGGAGCTGG - Intronic
1089152087 11:116372094-116372116 TTGGACAAGTATGGGGAAGAGGG - Intergenic
1089412917 11:118262350-118262372 TTTGTTAAGGCTGAGAGAGAGGG - Intronic
1089518488 11:119048578-119048600 AGGGGTAGGGATGAGGGAGAGGG + Intronic
1089572988 11:119422575-119422597 CTGGAAAAGGATGAGAGAGGGGG - Intronic
1089633751 11:119799248-119799270 TTGGACAAGGACGAGGCAGGAGG - Intergenic
1090890027 11:130915492-130915514 TCGGAGAAGGATGAGCGTGATGG - Exonic
1091316251 11:134615985-134616007 TGGGAAAGGGCTGAGGGAGAGGG + Intergenic
1092017990 12:5175460-5175482 TAGGATAAGGAGGCAGGAGAAGG - Intergenic
1092043127 12:5403234-5403256 TGGGATAAGGATGTAGGTGAAGG + Intergenic
1092107736 12:5934781-5934803 GTGGAGAATGATGAGGGACACGG - Intronic
1092123312 12:6059195-6059217 TTAAATAAGGAGGTGGGAGAAGG - Intronic
1094243014 12:28250627-28250649 TTGGAAAAGTAAGAGGGAAAAGG + Intronic
1095611330 12:44132083-44132105 ATGGATAAGAATTAGGGAGACGG + Intronic
1096463602 12:51836364-51836386 TTGGATGAGGATGAGGATGGTGG - Intergenic
1096809044 12:54158159-54158181 TTGGCTGAGGAAGAGGGGGAAGG - Intergenic
1097042501 12:56164263-56164285 GGGGAGAAGGGTGAGGGAGAGGG - Intronic
1097144873 12:56933261-56933283 TGGGATCAGGATGGGGGAGGGGG - Intronic
1097286198 12:57879438-57879460 TGGGATATGGATGTGGGATATGG + Intergenic
1097286222 12:57879538-57879560 TGGGATATGGATGTGGGATATGG + Intergenic
1097286250 12:57879658-57879680 TGGGATATGGATGTGGGATATGG + Intergenic
1097286259 12:57879698-57879720 TGGGATATGGATGTGGGATATGG + Intergenic
1098369808 12:69745808-69745830 ATGGATAGGGAGTAGGGAGATGG - Intronic
1098668052 12:73189386-73189408 TTTGATAAAAATGAGAGAGAGGG + Intergenic
1100357438 12:93844641-93844663 TTGGCCAAGAATGAGAGAGAAGG + Intronic
1100822897 12:98448140-98448162 TTAGACAATGAGGAGGGAGATGG - Intergenic
1101840610 12:108325049-108325071 GAGGAAAAGGAGGAGGGAGAAGG + Intronic
1102598747 12:114012894-114012916 AGGGAGAAGGAGGAGGGAGAGGG + Intergenic
1103215557 12:119198928-119198950 TGGGATAAGGGTAAGTGAGAGGG - Intronic
1103397674 12:120620526-120620548 TTGCTTAAGGATGAGGGTGATGG - Intergenic
1103455913 12:121065090-121065112 GTGGATAAGGTGGAGTGAGAGGG + Intergenic
1104164699 12:126216489-126216511 CTGGAGAACAATGAGGGAGAGGG - Intergenic
1104734201 12:131126888-131126910 ATGGATGAGGATGAGTGAAATGG + Intronic
1104938356 12:132379523-132379545 TTGCATAAGGAAGAGGCTGAAGG - Intergenic
1107727967 13:43318991-43319013 GTGGAAAAGGGTAAGGGAGAAGG + Intronic
1108096847 13:46911064-46911086 ATGGATATGGATGCTGGAGAAGG + Intergenic
1108192751 13:47959415-47959437 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1108297319 13:49037473-49037495 TTGGATAAGGAGGAGATAGAAGG + Intronic
1108966126 13:56304379-56304401 TTGGAGAATGGTGAGAGAGAAGG + Intergenic
1110046205 13:70834699-70834721 CTAGATAGGGATGAGGGAGTTGG + Intergenic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1111362799 13:87197329-87197351 TTTGATAAGGTTGAAAGAGATGG + Intergenic
1112877484 13:104062465-104062487 GTGGAAGAGGATGAGGGAGTAGG - Intergenic
1113081339 13:106523470-106523492 TTGGACAAGGAGGAGGAAGGAGG + Intronic
1113085372 13:106564826-106564848 GTGGATAAGGGAGAGGGAAAGGG - Intronic
1113322489 13:109249054-109249076 TTGGGTAAATATGAAGGAGAGGG - Intergenic
1113340816 13:109423834-109423856 TTGCCAAGGGATGAGGGAGAGGG - Intergenic
1114084152 14:19226793-19226815 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114307103 14:21433571-21433593 TTTTATAAGGATAAGTGAGATGG - Intronic
1114400358 14:22404670-22404692 TTGGATAAGCAGGAAGGAAAAGG + Intergenic
1114729763 14:24979697-24979719 TTTGAAAGGGTTGAGGGAGAAGG - Intronic
1114972058 14:28043728-28043750 TTGGAGATGGATGATGGTGATGG + Intergenic
1115364193 14:32538302-32538324 TTGTAGAATGATGAGGGAAATGG + Intronic
1115713711 14:36078362-36078384 TTGCTTAAGGGTGAGGTAGAGGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1118423180 14:65630852-65630874 TTAGAAAAGGATGAGGGTGGAGG - Intronic
1118927635 14:70207207-70207229 TGGATAAAGGATGAGGGAGAAGG - Intergenic
1119464364 14:74843150-74843172 GTGGGTAAGGATGGGGGGGAAGG - Intronic
1120086327 14:80278312-80278334 TTGGATATAGATGGGGAAGAGGG + Intronic
1120929545 14:89834990-89835012 GTTGGTAAGGATGAGGGTGATGG - Intronic
1121156159 14:91686584-91686606 GTTGATAGTGATGAGGGAGAGGG - Intronic
1121671677 14:95714711-95714733 TTGTGTATGGAAGAGGGAGAGGG - Intergenic
1122009641 14:98735554-98735576 TTGCATTCTGATGAGGGAGACGG + Intergenic
1122663879 14:103315837-103315859 CTGGATACAGATGAAGGAGAGGG - Intergenic
1122769653 14:104092318-104092340 TTGGAGAAGGAGGTGGGAGCAGG + Intronic
1202895759 14_GL000194v1_random:8641-8663 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1202899946 14_GL000194v1_random:29257-29279 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1202918725 14_KI270723v1_random:10820-10842 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1202925899 14_KI270724v1_random:23750-23772 TGGCAGAAGGATGAGGGAGTGGG - Intergenic
1124217454 15:27819412-27819434 TTGGAGATGGATGAGGCAGTGGG - Intronic
1125142118 15:36420441-36420463 TAGAATTAGGATGAGGGTGAGGG - Intergenic
1125200618 15:37098309-37098331 AGGGATAAAGATGAGAGAGAGGG + Intronic
1125865373 15:43042619-43042641 TTGGAGAAGGATGGTGGTGATGG + Intronic
1125890075 15:43259053-43259075 TGGGATAAGGCTGGGGGAGAAGG + Intronic
1126517364 15:49551245-49551267 TTGGCTCAGCATGAGGGAGAGGG + Intronic
1126705648 15:51402657-51402679 TAGGAGAAGGATGAGGGAGAGGG - Intronic
1127282915 15:57507082-57507104 TTGACAAAGGATGAGGGAAAGGG - Intronic
1128239190 15:66089439-66089461 TGGGGTAGAGATGAGGGAGAAGG - Intronic
1128353305 15:66906575-66906597 TTGGATAGGGAGGAGTGAGAAGG - Intergenic
1129508546 15:76103110-76103132 TTGGACCAGGATGAGAGAGGTGG + Intronic
1129659739 15:77546479-77546501 TGAGGTAAGGATGAAGGAGAGGG + Intergenic
1130438823 15:83930073-83930095 TTGGAAATGGATCAGGGACATGG + Intronic
1130970403 15:88727678-88727700 TGTGATAAGGATGAGGAAGCAGG + Intergenic
1131636525 15:94238682-94238704 TTCGTTAAGGGTGAGGGACAGGG + Intronic
1132196852 15:99919904-99919926 GTTGTTAAGGATGAGGAAGAAGG - Intergenic
1133462399 16:5998624-5998646 TTGGAAAAGGGTGAGGGAGGTGG - Intergenic
1133535053 16:6693725-6693747 GTGGATGAGGATGAGGATGATGG - Intronic
1134187967 16:12099308-12099330 TTCGAGAAGAATCAGGGAGAAGG - Intronic
1134330670 16:13248353-13248375 TTGGAGAAGGGGGAAGGAGAAGG - Intergenic
1134388154 16:13793678-13793700 TTGGATTAGAATGGAGGAGATGG - Intergenic
1134570576 16:15287445-15287467 TTGGTGAAGGAGGAGGGAAAGGG - Intergenic
1134729607 16:16450095-16450117 TGGGATAGGGATGAGGGGAAGGG + Intergenic
1134731804 16:16468611-16468633 TTGGTGAAGGAGGAGGGAAAGGG + Intergenic
1134832273 16:17333156-17333178 TTGAATGAGGATGAAGGAAATGG - Intronic
1134935642 16:18243390-18243412 TTGGTGAAGGAGGAGGGAAAGGG - Intergenic
1134937828 16:18261811-18261833 TGGGATAGGGATGGGGGAAAGGG - Intergenic
1135002732 16:18790420-18790442 TAGGAGAAGGACGAGGGTGAGGG + Intronic
1135008964 16:18856063-18856085 TAAGATAAAGATGAGGAAGAAGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1137710364 16:50562746-50562768 TTGGAGAGGGATGAGGGGGGAGG + Intronic
1137781189 16:51099080-51099102 TGAGAAATGGATGAGGGAGATGG - Intergenic
1137904622 16:52308235-52308257 TTGGATAAGTTTGAGGCAGATGG + Intergenic
1137913808 16:52406246-52406268 TTGGTAAAGAATGAGGCAGAGGG - Intergenic
1137914231 16:52411371-52411393 TAGAATTAGAATGAGGGAGAAGG - Intergenic
1138034532 16:53590969-53590991 TTGGATAAAGATGGGGAAGGGGG + Intergenic
1138252266 16:55510038-55510060 ATGGATAAGAGTGAGGCAGAAGG + Intronic
1138602721 16:58066245-58066267 TGGGATAAGGACTAAGGAGAGGG - Intergenic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1139255424 16:65536603-65536625 TGGGAGAGGGATGAGGGATAAGG - Intergenic
1139281907 16:65778528-65778550 TTGGGTGAGGGTGAGGGTGAGGG + Intergenic
1139673967 16:68510230-68510252 TTGGGTAAGGGAGAGGGAGGAGG + Intergenic
1139801872 16:69529481-69529503 TGGGATAAGAATTAGGGAGAAGG + Intergenic
1140421347 16:74821858-74821880 TTGGTTGAGGATTAGAGAGAGGG + Intergenic
1140554481 16:75905806-75905828 CTGTATAAGATTGAGGGAGAGGG - Intergenic
1140871178 16:79107906-79107928 TTGGAAAATGATTAGGGACATGG + Intronic
1141021323 16:80499331-80499353 TAGGATAAGGCTGAAGCAGATGG - Intergenic
1141514577 16:84535148-84535170 TGGGAGAAGGAGGAGGGAGTAGG - Intronic
1141680089 16:85538732-85538754 TTGGAAAAGGATCTGGGAGCAGG + Intergenic
1142524309 17:528259-528281 TTGGCAAAGGCTGAGGGAGGGGG - Intronic
1142899890 17:3005259-3005281 TGGGAAGAGGAGGAGGGAGAAGG + Intronic
1142958160 17:3535190-3535212 AGGGAGAAGGAGGAGGGAGAGGG - Intronic
1143473099 17:7188426-7188448 GTGGGTAAGGCTGAGGCAGAGGG - Intergenic
1143901926 17:10181027-10181049 TAGAATAAGGATGAGGGTGGCGG + Intronic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144698409 17:17321302-17321324 TTGAATAAGGATTGTGGAGAAGG + Intronic
1146923288 17:36727867-36727889 ATGGTGTAGGATGAGGGAGAGGG - Intergenic
1147158900 17:38559483-38559505 TGGGAAAAGGATGAGGTAGTAGG + Intronic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1150036308 17:61802892-61802914 GTTGATAAGGATGTGGGAAAAGG - Intronic
1150324928 17:64249240-64249262 TTGGTTAACGTTGAGTGAGATGG - Intronic
1150628598 17:66859816-66859838 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1150957811 17:69880750-69880772 TTGGATAAGTTTTAGAGAGAAGG + Intergenic
1151345739 17:73500262-73500284 ATGGAGAAGGATGGAGGAGATGG - Intronic
1151345746 17:73500292-73500314 ATGGAGAAGGATGGAGGAGATGG - Intronic
1151745900 17:76011669-76011691 CTGGAGAAGGCAGAGGGAGAGGG + Intronic
1152323776 17:79623941-79623963 TTGAAGAAGGAAGAGGGAGCTGG + Intergenic
1152540298 17:80971334-80971356 TCGGATAGGGAGGTGGGAGATGG - Intergenic
1152648174 17:81479881-81479903 TTGGATAATGAGGAGAGAGGGGG - Intergenic
1152664104 17:81557462-81557484 GTGGATAAGGACGAGCGAGTGGG + Exonic
1153423116 18:4930937-4930959 TTGGATATGGATGAAGAACAAGG + Intergenic
1154498944 18:14984767-14984789 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1155354574 18:24939951-24939973 CTGGAAAAGAATGAGGGAGATGG - Intergenic
1156566401 18:38196540-38196562 TTGGAGATGGATGAGGGATGTGG - Intergenic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157648522 18:49303044-49303066 GTGGATGAGGATGAAGGAGTGGG - Intronic
1157843707 18:50982831-50982853 GGGGAAAAGGAGGAGGGAGAAGG - Intronic
1158089398 18:53693005-53693027 GAGGATGAGGATGAGGGTGAGGG + Intergenic
1158482691 18:57835960-57835982 GTGGATAAGGGTGAGGGTCATGG + Intergenic
1159834828 18:73325591-73325613 GTGGCTAAGGGTGAAGGAGAAGG - Intergenic
1160046489 18:75391554-75391576 TTGCAAGAGGATGAGGAAGAAGG + Intergenic
1160449255 18:78950876-78950898 GTTGATAATGATGAGGGTGATGG - Intergenic
1160509634 18:79446036-79446058 TTAGTTAAGGTTGAGGCAGAGGG + Intronic
1160676381 19:393580-393602 GTGGGAAAGGATGATGGAGAAGG + Intergenic
1160676393 19:393622-393644 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676438 19:393799-393821 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160676476 19:393967-393989 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676615 19:394562-394584 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676710 19:394993-395015 ATGGAGAAGGATGACGGAGAAGG + Intergenic
1160676728 19:395069-395091 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676883 19:395700-395722 ATGGAGAAGGGTGATGGAGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695208 19:480564-480586 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695232 19:480690-480712 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695259 19:480880-480902 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695299 19:481095-481117 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695345 19:481307-481329 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695353 19:481358-481380 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160965298 19:1744688-1744710 AGGGAAAAGGATGAGGAAGAAGG - Intergenic
1161389257 19:4012722-4012744 TTTGATGAGGAGGAGGGAGGGGG + Intronic
1161633918 19:5375036-5375058 ATTGATGAGGGTGAGGGAGATGG + Intergenic
1162041673 19:7974670-7974692 TGGGATATGGAGGAGGGAGCAGG + Intronic
1163207782 19:15816007-15816029 TTGGAGAAGAATGAAGGTGACGG - Intergenic
1163719843 19:18893855-18893877 TGGGCTTACGATGAGGGAGACGG + Intronic
1164400662 19:27900078-27900100 TGGGACAAGGATGATGGAAATGG - Intergenic
1164591901 19:29512022-29512044 GAGGATGAGGATGAAGGAGAGGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164592313 19:29513556-29513578 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164592328 19:29513605-29513627 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164795836 19:31027760-31027782 TTGGATTAGGAAGTGGGGGAGGG + Intergenic
1164876926 19:31697618-31697640 TGGGGTCAGGCTGAGGGAGAAGG + Intergenic
1166085634 19:40472812-40472834 TGGGATGAGGAGGAGGGGGAAGG + Intronic
1202647543 1_KI270706v1_random:156418-156440 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
925076245 2:1018591-1018613 TTGGAAAAGGAGGAAGGAGCAGG + Intronic
925830281 2:7887271-7887293 TGGGATAAGGAGGAGGCTGAAGG - Intergenic
926698312 2:15785668-15785690 TTGGGGGAGGATGAGGGAGCTGG + Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
927487161 2:23496482-23496504 TGGGAGCAGGATGGGGGAGAGGG - Intronic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
929237746 2:39624434-39624456 GTGGAGAAGGAGGAGGGAAAAGG + Intergenic
930020254 2:46997603-46997625 TTGGAAACTGCTGAGGGAGAAGG - Intronic
930253618 2:49064160-49064182 TTGAAAATGGATGAGGGAGAGGG + Intronic
930732827 2:54744627-54744649 TGGGATGAGGAAGTGGGAGAGGG + Intronic
930733535 2:54751596-54751618 TTTGATAAGGATATGGGGGATGG - Intronic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931392346 2:61854802-61854824 GAAGATACGGATGAGGGAGATGG - Intergenic
932586150 2:73030570-73030592 TTGGAGATGGATGATGGCGATGG - Intronic
932688261 2:73891721-73891743 CTGGATCAGGGTGAGGGAGGGGG + Intergenic
932995438 2:76845784-76845806 TTTGGTAAGGAATAGGGAGAGGG + Intronic
933179998 2:79216677-79216699 GTGGCTAAGGGTGAAGGAGAAGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933646314 2:84815450-84815472 TTAAATAAGAAAGAGGGAGAGGG - Intronic
934310330 2:91857215-91857237 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
934909498 2:98237932-98237954 TTGGATAAGACTTAGTGAGAAGG + Intronic
935277184 2:101485097-101485119 TTGGAGAATGAAGAGGAAGATGG - Intergenic
935418133 2:102840205-102840227 TTGGGGAGGGATGAGGGAGTGGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936396899 2:112138371-112138393 TGGGCTAAGGACGAGGGAGGAGG - Exonic
936569785 2:113603460-113603482 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
936659604 2:114528106-114528128 TGGGATAAGGATGGGAGAGATGG - Intronic
936799018 2:116243730-116243752 TAGGATAAGGAAGCGAGAGAAGG + Intergenic
937074527 2:119091268-119091290 TTGGATATGGATGAAGGGGTAGG + Intergenic
937217302 2:120321079-120321101 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217306 2:120321092-120321114 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217315 2:120321121-120321143 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937309466 2:120893230-120893252 TTGGATGACGTGGAGGGAGAAGG + Intronic
938364616 2:130725282-130725304 TGAGATAAGGGTGAGGGTGATGG + Intergenic
938497907 2:131812854-131812876 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
938547837 2:132351883-132351905 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
939083598 2:137690128-137690150 TGGCATAAGGGTGAGGGAAAAGG - Intergenic
939610156 2:144300169-144300191 TTGGATAAAGATGGTAGAGATGG + Intronic
940005727 2:149007972-149007994 TTGGACAACGATGATGGAGGGGG + Exonic
940018720 2:149134166-149134188 CTGGAGAAGGATCAGGCAGAGGG + Intronic
940574504 2:155483644-155483666 ATGGATAATGAAGAAGGAGAAGG + Intergenic
941523464 2:166578098-166578120 TTGTATATGGGTGAGGCAGAGGG + Intergenic
941591132 2:167422067-167422089 GAGGAGGAGGATGAGGGAGAGGG + Intergenic
943339559 2:186663189-186663211 TTGGAAAAAGATGAAGGAAAAGG - Intronic
943962585 2:194285638-194285660 TTTGATAAGGATGTGGAAAAAGG - Intergenic
944142046 2:196467353-196467375 TTGGTATAGGATGAGGGGGAGGG + Intronic
944502078 2:200372263-200372285 TTGAATGAGGATAATGGAGAGGG - Intronic
944895392 2:204158850-204158872 TTGAACAATAATGAGGGAGATGG - Intergenic
945185760 2:207137843-207137865 CTGGGGAAAGATGAGGGAGAGGG + Intronic
945595868 2:211791211-211791233 TTAGATAAGAAAGAGGGACAAGG + Intronic
947514524 2:230790455-230790477 TGAGCTAGGGATGAGGGAGAAGG - Intronic
948091800 2:235301757-235301779 AAGGATAACGAGGAGGGAGAAGG - Intergenic
948923806 2:241081385-241081407 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1169101166 20:2950964-2950986 TTGCTTAAGGATGAGGGAGTGGG - Intronic
1170453708 20:16512609-16512631 TTGGATAAAGATTTGGGAGCTGG - Intronic
1170462007 20:16586346-16586368 TTGAATAAGGATGTGGGATTTGG - Intergenic
1170614103 20:17935227-17935249 CTGGATGGGGATGAAGGAGAGGG + Intergenic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171782705 20:29435516-29435538 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1171876704 20:30584656-30584678 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1172183806 20:33019344-33019366 TTGAAGAAGGATAAGGGAAAGGG - Intronic
1172427934 20:34868617-34868639 TTGGTCAGGGATGAGGGAGTTGG - Intronic
1173022028 20:39274821-39274843 TTGGACAAAGTAGAGGGAGAGGG + Intergenic
1173057357 20:39628375-39628397 TTGGAATGGGATGAGGAAGATGG + Intergenic
1173202698 20:40965929-40965951 TTGGAGGAGGATGAGGGTTAGGG + Intergenic
1173620075 20:44429930-44429952 TTGGACATGGATGAAGGTGAAGG - Exonic
1173803661 20:45910756-45910778 ATGGTTTAGGATGAGGGAGGGGG - Intronic
1174187407 20:48716500-48716522 TGGGATAAGGCTGAGTGAGCTGG - Intronic
1174686582 20:52461866-52461888 GTGGCTAAGCAGGAGGGAGAAGG - Intergenic
1175468348 20:59208245-59208267 CTGGATACAGAGGAGGGAGATGG - Intronic
1175677240 20:60957349-60957371 TTGTGTGATGATGAGGGAGATGG - Intergenic
1176604320 21:8816342-8816364 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1176615450 21:9024703-9024725 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1176619320 21:9044031-9044053 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1176709729 21:10139101-10139123 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178793520 21:35722220-35722242 TGGGATAAGGGAGAGGGAGCTGG - Intronic
1178856466 21:36254378-36254400 CTGGGAAAGGATGAGGGAGGAGG + Intronic
1178982120 21:37273508-37273530 TAGGAGGAGGAAGAGGGAGAAGG + Intergenic
1178984231 21:37289338-37289360 TTGTAGAGGGATGAGGGACAAGG + Intergenic
1179944959 21:44666899-44666921 CTGGATAAGGTCGAGGCAGAGGG + Exonic
1179946587 21:44682136-44682158 CTGGATAAGGTCGAGGCAGAGGG + Exonic
1180293819 22:10866410-10866432 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1180346610 22:11707949-11707971 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1180354377 22:11826072-11826094 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1180383877 22:12166283-12166305 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
1180496626 22:15895825-15895847 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1180537077 22:16403154-16403176 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1180557020 22:16586265-16586287 TAGGGTAAGAATGAGGGAGATGG - Intergenic
1181495796 22:23286778-23286800 TTGGATTAGGAAGAGGGTGAGGG + Intronic
1181595139 22:23909226-23909248 TTGGATATGGCTAAGGGAGAAGG + Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181993611 22:26857412-26857434 TTGGTTAAGGATGAAGGGGCAGG + Intergenic
1182114917 22:27750838-27750860 TGGGGTAAGGTTGAGGGGGAAGG + Exonic
1182916904 22:34042015-34042037 TTGCCTAGGGCTGAGGGAGAAGG - Intergenic
1182958606 22:34451203-34451225 ATTGATAAAGATGAGGGTGATGG - Intergenic
1184113763 22:42410143-42410165 TTGGATGAGGTTGAAGGAGATGG - Intronic
951096759 3:18641304-18641326 TCTATTAAGGATGAGGGAGATGG - Intergenic
951261773 3:20518229-20518251 CTGGATAGGGAGGAGAGAGAGGG - Intergenic
951410825 3:22363934-22363956 GTGGCTAATGTTGAGGGAGAAGG - Intronic
952113841 3:30156220-30156242 GGGGCCAAGGATGAGGGAGAAGG + Intergenic
952445993 3:33381280-33381302 TTGGAGAAAGATGATGGAGATGG - Intronic
952729826 3:36626953-36626975 TGAGCTAAGGATGAAGGAGATGG + Intergenic
952826613 3:37530001-37530023 GTGGATGAGGATGAAGCAGAGGG + Intronic
954336130 3:49918842-49918864 TTGGTAATGGATAAGGGAGAAGG - Intronic
954358411 3:50102641-50102663 TTGCATAAGGATGGGGGACTGGG + Intronic
955750753 3:62183817-62183839 ATGGGGAAGGATGAAGGAGAAGG + Intronic
956787488 3:72654562-72654584 GTGGATAATGATGATGGAGGTGG - Intergenic
956813874 3:72890153-72890175 TTGGGAAAGGCTGAGGCAGATGG - Intronic
956836895 3:73102949-73102971 GTGGATGAGGATGGGTGAGATGG + Intergenic
957238511 3:77626560-77626582 TTGGGTAACGGGGAGGGAGAGGG + Intronic
958042141 3:88239334-88239356 TTGGATAGGGAAGAGGCATAGGG + Intergenic
958052592 3:88367177-88367199 TTTGATAACAATGAGGGAGCAGG - Intergenic
958118771 3:89257390-89257412 TGGGATAAGGAAAAGGGAGTGGG - Intronic
958467453 3:94474677-94474699 TTAAATAAGGATTTGGGAGATGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959666523 3:108928270-108928292 CTGGATTAGGATGGTGGAGAGGG - Intronic
960470297 3:118055971-118055993 TTGGAAAAGGATGTGGAAGACGG - Intergenic
960781049 3:121317494-121317516 TTGTATAAAGAAGAGGGTGATGG + Intronic
961153594 3:124660360-124660382 TGGGAGAAGGAAGAGTGAGAGGG - Intronic
961686730 3:128638002-128638024 TTGGATACGGATGAAGCACATGG + Exonic
962306868 3:134295339-134295361 CAGGTTAAGGATGAGGGATAAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
964724365 3:159799037-159799059 TTGGGTAATGAAGAGGGAGAGGG + Intronic
965552349 3:169980171-169980193 TTGAATAAGGAAGAGAGAGATGG + Intronic
965802717 3:172511174-172511196 TGGGAAAAGGATGATGGAGGAGG + Intronic
966158217 3:176941305-176941327 GAGGACAAGGATGATGGAGAAGG - Intergenic
966252954 3:177887424-177887446 TTTGATGAGGGTGAGGGAGGAGG - Intergenic
966743704 3:183255450-183255472 GAGGATAAGGAAGAGTGAGAAGG - Intronic
966785347 3:183618393-183618415 TTAGAAAGGGTTGAGGGAGAAGG - Intergenic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
968527920 4:1073760-1073782 GGCGATAAAGATGAGGGAGATGG - Intronic
969669574 4:8582279-8582301 GTGGAGAAGGATGAGCCAGAGGG + Intronic
970817033 4:20168788-20168810 GGGGGTAAGGAAGAGGGAGAGGG - Intergenic
971562952 4:28104795-28104817 TTGGAGATGAATGAGAGAGAAGG - Intergenic
973330313 4:48905964-48905986 TAGGATGAGGATGAGGATGAGGG + Intronic
973373799 4:49274607-49274629 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
973383613 4:49335632-49335654 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
973387218 4:49520645-49520667 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
973867436 4:55127485-55127507 TTGGATAAAGGGGTGGGAGATGG + Intergenic
973869737 4:55154195-55154217 TTGAAAAAGGATTAGGGAGAGGG - Intergenic
974637648 4:64585431-64585453 AAGGATAAGCCTGAGGGAGAAGG - Intergenic
974884964 4:67807020-67807042 TTAGAGAAGGATAAGGGATATGG + Intergenic
975921531 4:79396157-79396179 ACAGATAAGGATCAGGGAGAAGG + Intergenic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
976297478 4:83486476-83486498 TTTCATAAGGGAGAGGGAGATGG + Intronic
976651099 4:87435686-87435708 TTGGATAAAGGGGAGTGAGAGGG + Intronic
978123995 4:105113752-105113774 GTGGAGAAGGATGATGGACAAGG - Intergenic
978749169 4:112227831-112227853 TTTGAAAAGGATGGGGAAGAAGG + Intergenic
978763847 4:112384201-112384223 TTGGAGTTGGATGAAGGAGAAGG - Intronic
978802396 4:112767892-112767914 TTGGGAGAGGATGAGAGAGATGG - Intergenic
978861717 4:113458000-113458022 TTGGTGAAGTATGTGGGAGAAGG + Intronic
979530279 4:121763663-121763685 TTGGTTCAGGATGGGGGAAATGG - Intronic
979660224 4:123244581-123244603 TTGTTTAAGAATGATGGAGAGGG + Intronic
980990223 4:139733248-139733270 TTTGATAAGGAGGAGAGAGTTGG + Intronic
981406450 4:144375280-144375302 GAGGTTAAGGAGGAGGGAGATGG - Intergenic
981658204 4:147136333-147136355 TTGGAAAAGGATGCTGGAGGTGG - Intergenic
982347770 4:154379810-154379832 ATGGAACAGGATGAAGGAGAAGG - Intronic
982759988 4:159270339-159270361 TTGGGTAAAAATGAGTGAGAAGG + Intronic
982990406 4:162266461-162266483 TTGCAGAAGGATGGGGTAGAAGG - Intergenic
983187590 4:164718053-164718075 TTTGATACAGATGTGGGAGATGG - Intergenic
983369335 4:166839269-166839291 CTGGTTATGGATGAGTGAGAGGG + Intronic
984479816 4:180285709-180285731 TTTGATAAAGGAGAGGGAGAAGG - Intergenic
984791589 4:183619764-183619786 TTGGGCAATGATGAGGGAGGGGG - Intergenic
984924728 4:184796657-184796679 TTCCATAAGGATGAAGGATAGGG + Intronic
985798589 5:1985285-1985307 GGGGATAAAGAAGAGGGAGATGG + Intergenic
986077398 5:4352224-4352246 TGGGAAAGGGATTAGGGAGAGGG + Intergenic
986517671 5:8581024-8581046 ATGGATCAGGAAGAAGGAGAGGG - Intergenic
986982196 5:13460894-13460916 TTGGATAAGGTTGTTGGAGAGGG + Intergenic
987195533 5:15522229-15522251 GAGGATAAGGAAAAGGGAGAAGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987280551 5:16409630-16409652 TTGGAGAAAGATGAGGTAGGGGG + Intergenic
987867539 5:23564687-23564709 ATGGAAAGGCATGAGGGAGAAGG - Intergenic
990106968 5:52276682-52276704 GTGGAAAAGGAAGAGGAAGATGG - Intergenic
990154323 5:52857503-52857525 TTGGCTAAAAATGAGGGAGATGG - Intronic
990558479 5:56960636-56960658 TCGGAGATGGAGGAGGGAGAAGG - Intronic
990887334 5:60609501-60609523 TTGGATAATGTGGAAGGAGAGGG + Intronic
991057297 5:62334527-62334549 TAGGAGAAGGAAGAGGAAGAGGG - Intronic
991625129 5:68593410-68593432 TAAGATAGGGCTGAGGGAGAGGG + Intergenic
992564535 5:77984879-77984901 TTGGTTTAGGGTGAGGGAGGAGG - Intergenic
992750923 5:79859837-79859859 TTGGAAAAAGTTGAGAGAGAAGG + Intergenic
993064300 5:83078786-83078808 TTTAATAAGGTTGGGGGAGAGGG + Intronic
994207904 5:97056531-97056553 ATGGATAATGAAGAAGGAGAAGG - Intergenic
994923237 5:106079927-106079949 CTGGATAAGAATGAGGTAGTTGG + Intergenic
995188748 5:109298523-109298545 TGGGATTTAGATGAGGGAGAGGG - Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
996103705 5:119473155-119473177 TTGGATAAAGATGTGGAAGTAGG + Intronic
996648612 5:125846012-125846034 TAGGACAAGGATGAGGGAATTGG - Intergenic
996661104 5:126003750-126003772 TTGGGGGAGGAGGAGGGAGAGGG - Intergenic
996787589 5:127256956-127256978 CTTCATAAGGAAGAGGGAGATGG + Intergenic
997339076 5:133128462-133128484 CTGGATAAGGCTCAGAGAGATGG + Intergenic
997396566 5:133564685-133564707 TTTGACAAGGATGAGGGACAAGG + Intronic
997865595 5:137460020-137460042 TAGGAGAAGTATGAGCGAGAAGG + Intronic
998147013 5:139734729-139734751 GTGGGCAAGGGTGAGGGAGAAGG - Intergenic
999112102 5:149130465-149130487 TTTCACAAGGATGAGGGATAAGG + Intergenic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999429424 5:151512975-151512997 TTGAATAAGGAAGTGGGAGTGGG - Intronic
1000422757 5:161057066-161057088 TTGGACAATGATGAGGTAGCTGG + Intergenic
1001633282 5:173192363-173192385 TCAGATGAGGATGAGGTAGAGGG + Intergenic
1001892097 5:175348199-175348221 TTGCAGAAGGCTGAGGGAGTAGG - Intergenic
1002557077 5:180050621-180050643 TAGAATAAGGAGGAGGGAAATGG - Intronic
1003409169 6:5848177-5848199 GAGTATGAGGATGAGGGAGAGGG - Intergenic
1003989977 6:11476610-11476632 GTGGAGATGGATGAGGCAGATGG + Intergenic
1004861790 6:19811453-19811475 ATGGATAATGATGAGGGTGAGGG - Intergenic
1007105920 6:39282758-39282780 TTGGGTATGGAGGAGGGAAAGGG - Intergenic
1007289255 6:40772820-40772842 TTTCATAGGGAAGAGGGAGAGGG - Intergenic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008764435 6:54894104-54894126 TAACTTAAGGATGAGGGAGAAGG + Intronic
1008860979 6:56150018-56150040 TTGGATATGGAGGAAGGAGAAGG - Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1009296983 6:61963595-61963617 TTGGAAAAGAAAGAGTGAGAGGG - Intronic
1009633814 6:66236712-66236734 GAGTATAAGGAAGAGGGAGATGG - Intergenic
1010780407 6:79939630-79939652 ATTGAGAAGGCTGAGGGAGAAGG - Intronic
1010870759 6:81035189-81035211 TGGAATAAGGAGGAGAGAGAGGG - Intergenic
1011171803 6:84513141-84513163 TTTTATAAGGCTGAGGCAGAAGG - Intergenic
1011779985 6:90777552-90777574 ATTGATAAGGAAGAGGTAGAAGG - Intergenic
1012290284 6:97447163-97447185 CAGGAGAAGGATGAGGGAGTAGG - Intergenic
1012817992 6:104048761-104048783 ATGTTTAAGTATGAGGGAGAAGG - Intergenic
1013701335 6:112773805-112773827 ATGGAGAAGTATGAGGGAAAGGG + Intergenic
1014116297 6:117671933-117671955 TTGGATAAGTACCAAGGAGAAGG - Intergenic
1016720104 6:147286798-147286820 TGGGAAAAGGCTGAGGGAGAAGG - Intronic
1016828921 6:148414346-148414368 ATGGTTCAGGATGAGGGCGAGGG + Intronic
1017702466 6:157088727-157088749 TGGGAAAAGGAGGAGGGAGATGG - Intronic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1019260023 7:76788-76810 ATGGATGAGGAGGAGGGAGTAGG - Intergenic
1020035989 7:4963384-4963406 TTGGAGTATGATGAGGGAGAAGG + Intergenic
1020986212 7:15137834-15137856 TAGGTTAAGGAGGAGAGAGAGGG + Intergenic
1021219253 7:17956418-17956440 TTGGATAAGCATGACACAGAAGG + Intergenic
1021919345 7:25468382-25468404 GTGGGTAAGGATGAGGGAGAAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022760795 7:33348154-33348176 TTGCTTAGGGATGAGAGAGATGG - Intronic
1023115708 7:36859956-36859978 ATTGAGTAGGATGAGGGAGAAGG - Intronic
1023792207 7:43762039-43762061 ATGGGGAAGGATTAGGGAGAGGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1025953791 7:66167039-66167061 AGGGATAAGGCTGAGGCAGAGGG - Intergenic
1026530652 7:71194475-71194497 TTGGAACTGGAGGAGGGAGAAGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026848983 7:73713176-73713198 TTGGATGTGGATGAGGGTGCAGG - Intronic
1026989956 7:74579315-74579337 TTTGAAAAGGAAGAGGAAGAAGG + Intronic
1027702896 7:81490979-81491001 ATAGATAAGGATGAGGGTGAGGG - Intergenic
1028309143 7:89308661-89308683 TTAGTTCAGGATGAGGGAGGTGG - Intronic
1028490473 7:91405864-91405886 TTGGACAAGGGAGAAGGAGAAGG - Intergenic
1028771909 7:94635315-94635337 TTGGATAAGAATGATTAAGAAGG + Intronic
1033159762 7:138984742-138984764 CTGGATAAGGATGGGACAGAGGG + Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033869162 7:145729015-145729037 TTTGATTTGGATGAGAGAGATGG + Intergenic
1034620310 7:152451729-152451751 TAGGGTAAGAATGAGGGAGATGG + Intergenic
1034859120 7:154581265-154581287 TTGGGGAAGGTGGAGGGAGAAGG + Intronic
1034880586 7:154759533-154759555 TTGCATAAGGCTCAGGGAGAGGG - Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035309896 7:157960239-157960261 TTGGAGATGGATGGTGGAGATGG + Intronic
1036092532 8:5682908-5682930 TTGGCTTATGATGAGGGAGCAGG - Intergenic
1037651312 8:20841413-20841435 TTGGGAAAAGATGAGGGAGGAGG + Intergenic
1038454894 8:27666815-27666837 TTGGATAGGGAGGAGGGGGTGGG - Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1039537484 8:38330534-38330556 TTGAATAAAGATGTGTGAGATGG + Intronic
1039831287 8:41217082-41217104 TTGGCAGAGGGTGAGGGAGAAGG + Intergenic
1041438234 8:57865025-57865047 CTGGAGAAGGATGATGGTGATGG - Intergenic
1041969443 8:63720617-63720639 TTGAAGATGCATGAGGGAGAAGG + Intergenic
1042652038 8:71053600-71053622 TGGGACTAGGATGAGGGAGTAGG - Intergenic
1043249562 8:78054326-78054348 ATGGATAAGAATTCGGGAGAGGG + Intergenic
1043376841 8:79659195-79659217 GTGGAGAAGGCTGTGGGAGAAGG + Intronic
1044130545 8:88518233-88518255 TTGGGAAAGAATGAGGCAGAAGG - Intergenic
1045896650 8:107226574-107226596 TAGGATAAGGTTGGGGGTGAGGG - Intergenic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1049881633 8:145068329-145068351 TTGGGTTAGGGTGAGGGTGATGG + Intergenic
1050276575 9:4007378-4007400 TTGAACCAGGAAGAGGGAGAGGG - Intronic
1052673496 9:31588383-31588405 TTGGATAAGGATTTTGCAGAGGG + Intergenic
1054327706 9:63722526-63722548 CTGCATAATGTTGAGGGAGAGGG + Intergenic
1054727787 9:68668969-68668991 TTGGAGATGGATGGTGGAGATGG + Intergenic
1055455223 9:76465805-76465827 TTGGATATGGTTGATGGAGAGGG + Intronic
1055550956 9:77431825-77431847 TTGGACAAGGGTGAGTGGGAGGG - Intronic
1058145808 9:101409939-101409961 TTGGATTAGTATAAGGGAGCTGG + Exonic
1058672703 9:107373980-107374002 CTGGAGAAGAATGAGTGAGAGGG + Intergenic
1058909420 9:109507188-109507210 TTGGATAAGGATAAAAGAAAAGG + Intergenic
1060876372 9:127086835-127086857 TTGGACTGGAATGAGGGAGATGG + Intronic
1061443191 9:130621045-130621067 TTGGATATGGATGGTGGTGATGG + Intronic
1061649033 9:132031264-132031286 TTGGTGAAGGCTGAGGTAGAGGG - Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638418 9:137503617-137503639 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1062670319 9:137704969-137704991 ATGGAAAAGGAAGAGAGAGAGGG - Intronic
1202794488 9_KI270719v1_random:108070-108092 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1203697496 Un_GL000214v1:112580-112602 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
1203551714 Un_KI270743v1:168432-168454 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1186677597 X:11835387-11835409 TTTGATAAGAAAGAAGGAGATGG - Intergenic
1187467061 X:19537120-19537142 TTGGAAATGGAGGTGGGAGAGGG + Intronic
1187813933 X:23210684-23210706 AAGGAAAAGGATTAGGGAGAAGG + Intergenic
1187947026 X:24436020-24436042 TAGGATAAGGATGAGGTAGGAGG - Intergenic
1188195178 X:27224198-27224220 TAGGAGAGGGATAAGGGAGAGGG - Intergenic
1189187121 X:39064084-39064106 TTGGATAAGGATCATGGAAGTGG + Intergenic
1189217677 X:39341005-39341027 ATGGATGAAGAAGAGGGAGAAGG + Intergenic
1189348453 X:40260032-40260054 TGGGATGAGGGTGAGGGTGAGGG + Intergenic
1189525450 X:41815054-41815076 TTTGGGGAGGATGAGGGAGATGG + Intronic
1190158857 X:48016239-48016261 AGGGAGAGGGATGAGGGAGAGGG - Intronic
1190158861 X:48016252-48016274 AGGGAGAGGGATGAGGGAGAGGG - Intronic
1190174554 X:48138510-48138532 AGGGAGAGGGATGAGGGAGAGGG - Intergenic
1190174558 X:48138523-48138545 AGGGAGAGGGATGAGGGAGAGGG - Intergenic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1192082288 X:68060073-68060095 TTGGGTAATGAAGAGGGAGGAGG - Intronic
1192368100 X:70491785-70491807 TAGGATGTGGGTGAGGGAGAGGG + Intronic
1192500315 X:71645868-71645890 TGGGAGAGGGAGGAGGGAGATGG + Intergenic
1194693072 X:97010341-97010363 TGGGATAGGGATGGGGGGGATGG + Intronic
1195162237 X:102182025-102182047 TTGGGCAAGGGTTAGGGAGAAGG + Intergenic
1195318449 X:103701142-103701164 AAGGAAAAGGAGGAGGGAGAGGG - Intergenic
1195377269 X:104240026-104240048 GTGGAAAAGGAAGAGGGAGTGGG + Intergenic
1196355837 X:114791440-114791462 TTGCATTGGTATGAGGGAGAGGG + Intronic
1196577377 X:117335179-117335201 TTGCAGAGGGAGGAGGGAGAAGG - Intergenic
1196894198 X:120318477-120318499 TTTGATGGGGATAAGGGAGAAGG - Intergenic
1197738292 X:129869664-129869686 GTGAATAAGGAAGAGGGAGGAGG - Intergenic
1199797161 X:151210915-151210937 TGGGATAAGGGTGATGGGGATGG + Intergenic
1201781319 Y:17725589-17725611 TAGGATTAGGATTAGGGACAGGG - Intergenic
1201820234 Y:18180401-18180423 TAGGATTAGGATTAGGGACAGGG + Intergenic
1202093409 Y:21217598-21217620 TGGGAGAGGGAAGAGGGAGAGGG + Intergenic
1202172717 Y:22067679-22067701 TAGGATTAGGATTAGGGACAGGG - Intergenic
1202218645 Y:22518692-22518714 TAGGATTAGGATTAGGGACAGGG + Intergenic
1202324541 Y:23677363-23677385 TAGGATTAGGATTAGGGACAGGG - Intergenic
1202546230 Y:25992691-25992713 TAGGATTAGGATTAGGGACAGGG + Intergenic