ID: 1110786237

View in Genome Browser
Species Human (GRCh38)
Location 13:79530410-79530432
Sequence AAATTGCCACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110786237 Original CRISPR AAATTGCCACAGCTGGAGCT GGG (reversed) Intronic
903141543 1:21342216-21342238 AAGGTGCCACAGCTGCAGATGGG + Intronic
904788344 1:32999059-32999081 AAGCTGCTACAGCTAGAGCTGGG - Intergenic
906336146 1:44933115-44933137 AAATTCACACAATTGGAGCTTGG + Intronic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
907528873 1:55072809-55072831 GAATTCCCACCACTGGAGCTGGG - Exonic
908662009 1:66446907-66446929 AAATGTCCACATCAGGAGCTTGG - Intergenic
909265961 1:73558522-73558544 AAATGGCCCAAGCTGTAGCTTGG - Intergenic
909400124 1:75218714-75218736 AAATTGCCAAAGCTTGCCCTGGG - Exonic
910216832 1:84851897-84851919 AAAATGCCTCAGCTGGTGGTGGG + Intronic
911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG + Intronic
914932620 1:151948540-151948562 AAATTCTCACAAATGGAGCTGGG + Intergenic
915725285 1:158012971-158012993 AAATTGTCACACCTGGAGACTGG - Intronic
916502770 1:165400908-165400930 AAATTGGCACTGCTGGAGCATGG - Exonic
917815731 1:178708143-178708165 AAGTTTCCACAGCTGGGGCTGGG + Intergenic
918568991 1:185965080-185965102 AAAATACCTCAGCTGAAGCTAGG + Intronic
918813027 1:189145159-189145181 AAATTGACAAAACTTGAGCTAGG + Intergenic
919758531 1:201081680-201081702 TAATTCCCAATGCTGGAGCTGGG + Intronic
919993703 1:202728295-202728317 TAATTGCCACAGCTGTATTTTGG - Exonic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
923134557 1:231106775-231106797 TAAATGTCCCAGCTGGAGCTTGG + Intergenic
923796226 1:237158603-237158625 AAAATGCTACAGCTGAAGATGGG - Intronic
924860619 1:247916893-247916915 AACTTGCAAAAGCTGGAGCCAGG + Intergenic
1063624910 10:7679884-7679906 ACATGGCCAGAGCAGGAGCTAGG + Intergenic
1064774695 10:18763459-18763481 AAATGGCCACCGCTGGACATAGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1069585795 10:69601001-69601023 ACATGGCCACCTCTGGAGCTGGG + Intergenic
1070592273 10:77809656-77809678 AAAAAGTCCCAGCTGGAGCTTGG - Exonic
1071243193 10:83732708-83732730 AAATTGGCACACCTTTAGCTAGG - Intergenic
1076346751 10:129784689-129784711 AAACTGCATCAGCTGGAGCTGGG + Intergenic
1076495246 10:130892996-130893018 AGATTGCCACAGCTGGACCAAGG + Intergenic
1083281230 11:61628416-61628438 AATTTGCCACTGCTGGTGCTGGG - Intergenic
1083417220 11:62533576-62533598 AAATGTCCACTGCTGGAACTTGG + Exonic
1085224762 11:74909662-74909684 AAACTGCCACAGGAGGGGCTCGG - Intronic
1086849703 11:91794861-91794883 AAATGGCCACACCTGGAGGAAGG - Intergenic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089733144 11:120532095-120532117 AGACAGCCACAGCTGGAGCCGGG + Intronic
1095546940 12:43383477-43383499 AATTTGACACAGCTGAAACTGGG - Intronic
1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG + Intronic
1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG + Intergenic
1096531806 12:52247326-52247348 AAATGGCCCCTGCTGGTGCTGGG - Intronic
1097437885 12:59572535-59572557 AAATTGCCACAGATGAGTCTAGG - Intergenic
1098064679 12:66601310-66601332 AAACTGCCTATGCTGGAGCTGGG + Intronic
1098625801 12:72665717-72665739 AAATTGCTATGGCTGGAGGTTGG - Exonic
1099282929 12:80675755-80675777 AAATTGTCACAGCTTGGGATGGG + Intronic
1101513582 12:105414221-105414243 AGAATGCCAAGGCTGGAGCTGGG + Intergenic
1104515337 12:129420050-129420072 AAAAGGCCACACTTGGAGCTTGG + Intronic
1105274172 13:18905163-18905185 CACTTGCCACAGCTGGAGGCTGG - Intergenic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1107038169 13:35921859-35921881 AAGTTGCCACCCCAGGAGCTGGG + Intronic
1109726459 13:66347741-66347763 AAATGGACACAGCTGAAGGTCGG - Intronic
1110359649 13:74610686-74610708 AAATGGCCAGAGCTGTACCTTGG - Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1112119919 13:96398572-96398594 AAAATGCAACAGATGGGGCTGGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113729933 13:112634160-112634182 AAGTTGCCAGTGCAGGAGCTGGG + Intergenic
1114564663 14:23621544-23621566 AATTGGCCACAGCTGGTGCCAGG + Intergenic
1114888304 14:26883084-26883106 GAATTGCATCAGTTGGAGCTGGG + Intergenic
1115038856 14:28895657-28895679 AAATTGCCACTGCTGCACATTGG + Intergenic
1116581414 14:46646986-46647008 AATATGCCACAGCTGGAGAGTGG + Intergenic
1121366823 14:93320309-93320331 AAATTGCCACAACTGGACAGGGG + Intronic
1121919093 14:97863982-97864004 CAGTTGCCACAGCTGGAAGTTGG + Intergenic
1122086350 14:99309350-99309372 TAATTCCCACTGCTGGAGGTGGG + Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122355780 14:101122142-101122164 AAATAGCCTCAGCTGGCACTTGG - Intergenic
1123805007 15:23861475-23861497 AAAATGCCACAGTTAGAGCAGGG - Intergenic
1125551371 15:40547396-40547418 AAAGTCCCACTGCTGAAGCTCGG - Intronic
1129912273 15:79238259-79238281 AAATTGCAACAGCTGGAAAATGG + Intergenic
1132953650 16:2579178-2579200 TAGTTGTCACAGCTGGAGCAGGG + Intronic
1132960701 16:2620989-2621011 TAGTTGTCACAGCTGGAGCAGGG - Intergenic
1133119377 16:3596780-3596802 AAAATGCCTCAGATGGAGCCCGG - Intronic
1133480412 16:6165126-6165148 AAACTGCCAAAGCTGAGGCTTGG - Intronic
1133660346 16:7910359-7910381 AACAGGCCACAGCTGGGGCTTGG + Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1137433719 16:48438599-48438621 AAATTGCCTCACCTGGAAATAGG + Intronic
1139653328 16:68373495-68373517 AAAGTGCCAGGGCAGGAGCTGGG - Intronic
1141780866 16:86159866-86159888 AAATATCCATAGCTTGAGCTAGG - Intergenic
1148079098 17:44957699-44957721 AAATGGCCACAGCTGGCAGTGGG + Intergenic
1148995914 17:51709543-51709565 AAATTTCCACCTCTGGAGGTGGG - Intronic
1149780197 17:59391526-59391548 AAATTGTCCCAGGTGGAGCCTGG + Intronic
1152388322 17:79988349-79988371 AATCAGCCACAGCTGGAGCCAGG - Intronic
1152450573 17:80376610-80376632 GAGTTCCCACAGCTGCAGCTCGG - Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153323026 18:3792161-3792183 AAGTACCCACAGCTGGAGTTAGG - Intronic
1154465876 18:14642415-14642437 CACTTGCCACAGCTGGAGGCTGG - Intergenic
1156115368 18:33780859-33780881 TAATTGCCAATGCTAGAGCTGGG - Intergenic
1158371616 18:56812739-56812761 AAATTCTCACTCCTGGAGCTGGG - Intronic
1158620327 18:59027277-59027299 AAAAAGGGACAGCTGGAGCTGGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160876203 19:1297226-1297248 AATTTCACACAGCAGGAGCTGGG - Intronic
1161220833 19:3117368-3117390 AAAAGGGCACAGCTGGAGCTGGG - Intronic
1162857424 19:13479576-13479598 AAATGGCAACTTCTGGAGCTTGG + Intronic
1164606593 19:29603455-29603477 AATTGGCCACAGCTGGCGCTAGG - Intergenic
1164768653 19:30791195-30791217 AAATTGCCAAAGGTGGAGTGTGG + Intergenic
1167088166 19:47324570-47324592 CAATTGCCAAATCTGTAGCTTGG + Intergenic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
1168105543 19:54163847-54163869 GAGTTGCCACTGCTGAAGCTTGG - Exonic
924978705 2:200746-200768 CAAACGCCAGAGCTGGAGCTCGG - Intergenic
926738829 2:16094448-16094470 ACAGAGCCAGAGCTGGAGCTGGG + Intergenic
933804405 2:85987683-85987705 AAAGTCACACAGCTGGAGCCAGG - Intergenic
935719401 2:105966919-105966941 AAATGGCCAAAGCTAGAACTGGG - Intergenic
938092875 2:128444675-128444697 AACTTCCCACAGCGGGGGCTTGG - Intergenic
939858439 2:147389277-147389299 AATTTGTCACAGCTGGTGCCAGG + Intergenic
939991849 2:148883042-148883064 AAATTGCCAGAGCTGGACAGAGG - Intronic
942890635 2:180982079-180982101 GAACTGCCACTGCTGGTGCTGGG - Exonic
945268723 2:207917219-207917241 AAATTTCATCAGCTGCAGCTGGG - Intronic
945497793 2:210530828-210530850 AAATTGCTACAGTTAGAGGTGGG - Intronic
948018590 2:234710905-234710927 AAATTCCTACATCTGGATCTCGG + Intergenic
948383094 2:237564458-237564480 AAAGTGCCACAGGTGGAGGAAGG + Intergenic
1169394552 20:5218180-5218202 AGATGCCCACAGCTAGAGCTTGG - Intergenic
1169896670 20:10511502-10511524 AAATTAAAACAGCTGGAGGTAGG - Intronic
1171378881 20:24717359-24717381 AAATTGACACATCTGTAACTAGG - Intergenic
1173040950 20:39461729-39461751 TGATTGTCACAGCTGGAGTTAGG - Intergenic
1173458890 20:43225835-43225857 GAATTGGCAGAGGTGGAGCTTGG + Intergenic
1174365644 20:50054747-50054769 GAAGTCACACAGCTGGAGCTAGG + Intergenic
1174749204 20:53095415-53095437 GACATGCGACAGCTGGAGCTGGG + Intronic
1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG + Intronic
1176119258 20:63446623-63446645 ACATGGCCAGAGCTGGGGCTGGG + Intronic
1176291904 21:5050230-5050252 AAATGGCCACAGCAGGAGTATGG + Intergenic
1176808710 21:13516179-13516201 CACTTGCCACAGCTGGAGGCTGG + Intergenic
1178169610 21:30025215-30025237 AAATTGCCACTGCTTGTGTTAGG + Intergenic
1178694570 21:34781748-34781770 AAATGGCCACAGGAGGTGCTGGG - Intergenic
1179865353 21:44213411-44213433 AAATGGCCACAGCAGGAGTATGG - Intergenic
1180155511 21:45975400-45975422 AAATTTCCCCAGCTGGGGCCTGG + Intergenic
1182105344 22:27685242-27685264 AAATTCACACAGCTGGGGCTGGG - Intergenic
1184057936 22:42065090-42065112 AAAGTGGCAGAGCTAGAGCTGGG + Intronic
1185133516 22:49055289-49055311 AAATTGGCTCAGCTTGAGCACGG - Intergenic
949948539 3:9209729-9209751 AAATTGCCACCAATGGAGTTTGG + Intronic
950135643 3:10578955-10578977 AACGTGCTACAGCTGGATCTGGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950975596 3:17239542-17239564 AATAGGCCACAGCTGGAGCTTGG - Intronic
951510180 3:23491773-23491795 AAATTGCCCTAGCTGCAGTTTGG + Intronic
951891589 3:27572752-27572774 AAATAGATACAGCTGGATCTAGG - Intergenic
952154464 3:30627828-30627850 AAATAGCCACAGGTGGCTCTTGG + Intronic
952829442 3:37552121-37552143 AGATCGCTACAGCTGGATCTGGG + Intronic
953194480 3:40719732-40719754 AATTGGCCACAGCTGGCGCCAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953627407 3:44582093-44582115 AATTTGCCACAGCTGGATACAGG + Intronic
954920500 3:54186898-54186920 TCATGGCCACACCTGGAGCTTGG - Intronic
955500033 3:59574400-59574422 AGCTTGCCACTGGTGGAGCTGGG - Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
964191244 3:154003588-154003610 AAATTTCCATACCTGGAGATGGG + Intergenic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
965071982 3:163925803-163925825 AAATAGACACAGCTGGTGCCAGG - Intergenic
966056524 3:175699150-175699172 AAATTTGCTCAGCTGAAGCTTGG - Intronic
970895623 4:21100253-21100275 AAATTGCCACAGCCTTGGCTGGG + Intronic
977726938 4:100306905-100306927 AAGTTACCACAGCTAGACCTTGG + Intergenic
978951154 4:114561318-114561340 AAAATGGGACAGCTGGAACTGGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
981558722 4:146023869-146023891 ACATGGCCACTGCTGGGGCTGGG + Intergenic
982554027 4:156838360-156838382 CAATTGCCATAGCAGGAACTAGG - Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983713094 4:170744008-170744030 AATTGGTCACAGCTGGAGCGAGG - Intergenic
983859206 4:172683997-172684019 TAATTCGCAAAGCTGGAGCTGGG - Intronic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
988056705 5:26106362-26106384 ACATTGCCACTGCTGGGGATGGG + Intergenic
988936931 5:36093278-36093300 AAATTGTCACAACTGATGCTTGG - Intergenic
992085588 5:73275354-73275376 AAAATGGAACAGCTGTAGCTGGG + Intergenic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
995859638 5:116627964-116627986 AAAGAGCCACATCTGGGGCTGGG + Intergenic
996151101 5:120035911-120035933 AATTGGCCACAGCCGGTGCTAGG + Intergenic
996839370 5:127829537-127829559 AAATTGCTATAGGAGGAGCTAGG + Intergenic
998298948 5:140999871-140999893 AAATTAGCCCAGCTGTAGCTTGG + Intronic
998309702 5:141116221-141116243 AAATTGGCAAAGCTTTAGCTAGG + Intronic
999947800 5:156616328-156616350 ATATTCCCACTGCTAGAGCTAGG + Intronic
1000267436 5:159651253-159651275 AAATTGCGACAGGTTGAGTTTGG - Intergenic
1000592463 5:163174899-163174921 AAATTGCCTAAGCAGGAGCGAGG - Intergenic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1004772853 6:18805066-18805088 AAATTGATACAGCTTTAGCTGGG - Intergenic
1004782494 6:18925961-18925983 AAATTGGCAAAACTGGAGCCAGG - Intergenic
1005662916 6:28018548-28018570 AATTTGCTGCAGCTGGAGTTAGG + Intergenic
1006021294 6:31119288-31119310 GAATTGGCACAGCTGGGGTTCGG - Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1020089711 7:5332453-5332475 ACTTAGCCACAGCAGGAGCTGGG - Intronic
1020427736 7:8088876-8088898 AAATTTCTACAGCTGGATGTAGG - Exonic
1021186992 7:17576059-17576081 AAATTGCAACAACTCCAGCTAGG + Intergenic
1022275160 7:28847753-28847775 AAGCTGCATCAGCTGGAGCTGGG + Intergenic
1023729685 7:43178713-43178735 AAGGTGCCACAGCTAGAGGTTGG + Intronic
1026176074 7:67998139-67998161 AAAGTGGCTCAGCTGGAGATTGG + Intergenic
1026454171 7:70556303-70556325 TAATTGCCAATGCTGGAGGTGGG - Intronic
1028207711 7:88035321-88035343 CAATTGACACAACTGGATCTAGG - Intronic
1028613614 7:92739311-92739333 AAGTTTGCACATCTGGAGCTTGG - Intronic
1029042926 7:97596842-97596864 TAATTGCCAATGCTGGAGGTGGG + Intergenic
1029157385 7:98526791-98526813 AAATTGCCTCAGCTGTGCCTAGG + Intergenic
1029469968 7:100748166-100748188 CAACTGCCACAGCTGGCTCTGGG - Exonic
1032488565 7:132306701-132306723 GAGTTGCCACAGCTGGAACCAGG + Intronic
1033835243 7:145302580-145302602 AAATGGTCAGTGCTGGAGCTAGG - Intergenic
1035225232 7:157428894-157428916 AAGTGGCCACAGCTGGGGCGGGG + Intergenic
1035929972 8:3769737-3769759 AAATTGCCATAGCAGGACATTGG - Intronic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1041865450 8:62568081-62568103 AAATTGCCACACCTAGATATGGG + Intronic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044261724 8:90132564-90132586 AATTTGTCACGGCTGGAGTTAGG - Intergenic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1046548970 8:115688453-115688475 AAATTTCCTTAGCTGGATCTTGG + Intronic
1047022291 8:120787138-120787160 AAATACCCAGAGCTGAAGCTAGG + Intronic
1053006877 9:34610839-34610861 CGAGGGCCACAGCTGGAGCTGGG + Exonic
1053421234 9:37980099-37980121 AAATTCCCACAGCTGGGGGGAGG - Intronic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1060120661 9:120986653-120986675 AAACTGACACAGCAGGACCTGGG - Intronic
1061930547 9:133830687-133830709 GAATTTTCAAAGCTGGAGCTGGG - Intronic
1062166124 9:135108153-135108175 AAATTGTGACAGCTGAGGCTTGG + Intronic
1062527994 9:136985928-136985950 AAAGTCCCAGAGCTGGGGCTGGG - Intronic
1186917993 X:14244304-14244326 GAACTGCCACTGCTGGTGCTGGG - Intergenic
1187312419 X:18158061-18158083 TAATACCCACTGCTGGAGCTGGG + Intergenic
1193066621 X:77267307-77267329 AATTGGTCACAGCTGGAGCCAGG + Intergenic
1193387323 X:80886579-80886601 AAATTGCCTAAGCTGTACCTTGG + Intergenic
1194985143 X:100482077-100482099 AAATTACAATAGCTGGGGCTAGG - Intergenic
1195749200 X:108147285-108147307 ATATTGCCACTACTGGAGATGGG + Intronic
1197497743 X:127207095-127207117 AGATTGCCTCAGGTGGAGATAGG + Intergenic
1198686151 X:139230107-139230129 AAATTGGCAATGCTGGAGGTGGG + Intergenic
1199675282 X:150183697-150183719 AAGTGGCCCCAGCTAGAGCTGGG + Intergenic