ID: 1110787559

View in Genome Browser
Species Human (GRCh38)
Location 13:79548589-79548611
Sequence CAGTGTAAAGAGTCAGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110787559 Original CRISPR CAGTGTAAAGAGTCAGTGGC GGG Intronic
900297571 1:1959646-1959668 CAGGGGAAAGAGTCAGTAGAGGG + Intronic
900585531 1:3430700-3430722 CACTCTGCAGAGTCAGTGGCTGG + Intronic
901240733 1:7691682-7691704 CTGTGTGAAAAGTCAATGGCAGG + Intronic
901483232 1:9540016-9540038 CATTCTGAAGAGTCAGTGGCCGG + Intronic
906301353 1:44684180-44684202 CAATTTCAAGAGTCAGTTGCTGG - Intronic
909593236 1:77375828-77375850 CAGGGTGAAGAGTCAGTCGCAGG - Intronic
909979611 1:82082988-82083010 CAGTCAGAAGAGTCAGTGTCAGG + Intergenic
911089764 1:94009224-94009246 CAGAGTAAAGACTCAGGGCCTGG + Intronic
916077225 1:161208593-161208615 CACTGTCAAGAGTCCTTGGCCGG - Intronic
918162910 1:181918004-181918026 GAGTGCAAAGAGTTTGTGGCTGG - Intergenic
920068667 1:203287307-203287329 CACTGGTAAGAGCCAGTGGCTGG + Intergenic
920706918 1:208258120-208258142 CAGTGAAAGGAGGCAGTGGGTGG - Intergenic
921738345 1:218654701-218654723 CAGTGTAGAGAGTGACTGGGCGG + Intergenic
1062785465 10:261087-261109 CAGTCTAGAGAGTCACGGGCAGG - Intergenic
1063790292 10:9437268-9437290 TAGTGTAAAGAGCCAGTTGGAGG + Intergenic
1063972104 10:11388407-11388429 GAGTCTAAAGGGTCAGTGCCGGG - Intergenic
1064776886 10:18788419-18788441 CATTGTCAAAAGTCAGTTGCTGG - Intergenic
1066004861 10:31136711-31136733 TAATGTAAAGAGTAAGTTGCAGG - Intergenic
1066706526 10:38185293-38185315 CAGTGGAAGAAGTCAGTGGTTGG + Intergenic
1068225983 10:54107744-54107766 CAATGTAAAGAATCAGAGCCTGG + Intronic
1068779866 10:60907812-60907834 CAGTGGAAAGAGTGAGAGCCAGG + Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1079357933 11:19745508-19745530 CAGTGTCAAAAGCCAGGGGCAGG - Intronic
1081025830 11:38013704-38013726 GAGTGTAAAGAGTAGTTGGCTGG - Intergenic
1083770372 11:64863778-64863800 CAGGTCACAGAGTCAGTGGCAGG - Intronic
1085771739 11:79331596-79331618 CAGTGTAAGGAGACTGTGGGAGG + Intronic
1085812566 11:79697996-79698018 CAGTGCAAAGATTTTGTGGCTGG + Intergenic
1088143237 11:106643959-106643981 CATTTTAAAGACTCAGTTGCAGG + Intergenic
1090086860 11:123657703-123657725 CATTGTAAATAGTCACTGTCAGG + Intergenic
1090135580 11:124195227-124195249 CAGTCTAAGAAGTCAGTAGCTGG + Intergenic
1091220594 11:133927960-133927982 CAGTGCACAGAGTTAGAGGCAGG + Intronic
1094344549 12:29452797-29452819 TAGTGTAAAAAGTTAGTAGCGGG + Intronic
1095051557 12:37559123-37559145 CATTGAAAATAGTGAGTGGCTGG - Intergenic
1096272507 12:50177461-50177483 CAGAGTGAAGAGTCTGTGGGTGG - Exonic
1099325335 12:81208112-81208134 CACTGTAAAGATTCAGAGGTGGG + Intronic
1100433630 12:94552201-94552223 AAGTGTAAAGAGGCCATGGCTGG + Intergenic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103162526 12:118741452-118741474 AAGTGCAAAGAGTCTGAGGCAGG - Intergenic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1104167439 12:126247256-126247278 CTGTGCAAAGGCTCAGTGGCTGG + Intergenic
1108685704 13:52817365-52817387 CAGAGAACAGAGTCAGAGGCAGG + Intergenic
1110588929 13:77231001-77231023 GAGTGTAAATGGTTAGTGGCTGG + Intronic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1110966326 13:81702308-81702330 CAGTGTAATTAGTAAGTGGTAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112769422 13:102779831-102779853 CAGGGTAGGGAGTCAGTGGATGG + Intergenic
1112928222 13:104703710-104703732 CAGTATAAAGAGACAATGGGTGG + Intergenic
1113509201 13:110838821-110838843 CATTGGAGAGAGTGAGTGGCAGG - Intergenic
1114306561 14:21429047-21429069 CAGAGGACAGAGTCACTGGCTGG + Exonic
1114733367 14:25018236-25018258 CTGTGTTAGGAGTCAGTTGCAGG - Intronic
1114752718 14:25223561-25223583 CAGTGTTAAGAGTCAGAGCCTGG - Intergenic
1116178834 14:41509884-41509906 AAGTGTAAAGATTCAGAGGTGGG + Intergenic
1116282616 14:42928405-42928427 CAGTGTGAAGACACATTGGCTGG + Intergenic
1116580667 14:46637325-46637347 CAGTGTTGAGAGTCTGTGGGTGG + Intergenic
1118014127 14:61640959-61640981 CTGTGTGAAGAGGCATTGGCAGG + Intronic
1121184740 14:91956722-91956744 CACTGTCAAGAGGCAGAGGCTGG + Intergenic
1121325485 14:93017340-93017362 CAGTGTGAAGTGCAAGTGGCTGG - Intronic
1122243492 14:100384365-100384387 CAGTGTGAAGAGTGTATGGCAGG + Intronic
1122955417 14:105068097-105068119 AACTGTAGAGAGACAGTGGCCGG + Intergenic
1124012624 15:25850808-25850830 CAGTTTAAAAAGTCAGGGGCAGG - Intronic
1127570344 15:60235427-60235449 CATTTCACAGAGTCAGTGGCTGG - Intergenic
1128371568 15:67043501-67043523 TAGTGTTAAGAGACAGTAGCTGG - Intergenic
1129445810 15:75617009-75617031 AAGTGGAAGGAGTCAGTGGTAGG + Intronic
1129672114 15:77613241-77613263 CAGTGGAGAGAGCCAGGGGCTGG - Exonic
1132811838 16:1803381-1803403 CACTATAAAGTGTGAGTGGCAGG - Intronic
1134039055 16:11053907-11053929 AAGTGGGAAGAGACAGTGGCAGG + Intronic
1137480856 16:48850692-48850714 CAGTGTGAAGGTTCAGTGGCAGG - Intergenic
1138548110 16:57731338-57731360 CTGTGTAAACAGGCATTGGCTGG - Exonic
1139694144 16:68661454-68661476 CAATGTTAAGTGCCAGTGGCAGG + Intronic
1139833445 16:69819462-69819484 CAGTGCCAAGGGTCAGTGGCAGG - Intronic
1141691730 16:85600480-85600502 TAGTGTTGAGAGGCAGTGGCTGG + Intergenic
1142051185 16:87959430-87959452 TTGTGTAGAGAGGCAGTGGCTGG + Intronic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142803444 17:2359355-2359377 CAGTGTGAACAGTTACTGGCCGG + Intronic
1145078634 17:19876147-19876169 GAGAGTAAAGAGTTGGTGGCCGG + Intergenic
1147357592 17:39909971-39909993 GAGGGAAAAGAGTCAGTGGGAGG - Intronic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1149036705 17:52142255-52142277 CATTTTTAAGAGTCAGTGACAGG + Intronic
1151234573 17:72710189-72710211 CAGAGTAGAAAGTCACTGGCAGG - Intronic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151440070 17:74122749-74122771 AAGTGCAAAGGGTCAGAGGCAGG - Intergenic
1152439474 17:80297050-80297072 CAATGTACAGAGTTAGTGCCGGG + Intronic
1153886920 18:9475534-9475556 CATTGTAAACAGGCAGAGGCTGG + Intronic
1156434024 18:37106907-37106929 TAGTGTAAGGGGTAAGTGGCAGG - Intronic
1159891408 18:73956430-73956452 CAGGTTAAAGAGACAATGGCAGG - Intergenic
1160094820 18:75861774-75861796 CAGGGTAATGAGTCAGAGGTGGG + Intergenic
1160676348 19:393413-393435 CAGTGTACAGAGTCAGCAGGTGG + Intergenic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1163780418 19:19244238-19244260 CAGTGTGAAGGCTCAGAGGCAGG - Intronic
1163980845 19:20898546-20898568 CAGTGTGATGACTGAGTGGCTGG - Intergenic
1164123674 19:22290774-22290796 CAGTGTGCAGAGTCTGTGTCTGG + Intronic
1164655887 19:29921511-29921533 CAGTGCCAAGAGTGAGTGGTTGG + Intergenic
1166659489 19:44637083-44637105 TAAGGTAAATAGTCAGTGGCTGG - Intergenic
1168346034 19:55650658-55650680 CAGTGAGAGGAGACAGTGGCAGG - Intronic
1168367101 19:55797851-55797873 GAGTGGAAAGAGTCAGAAGCAGG + Intronic
927562865 2:24085664-24085686 CAGTGTAGGGGGTCAGTGGATGG - Intronic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
928255852 2:29721828-29721850 CAGAGTAAAGGGACAATGGCTGG - Intronic
929322589 2:40562735-40562757 CATTGGAAAGAGGCAGTGTCCGG + Intronic
930036083 2:47086056-47086078 CAGAGGAAAGAGTCAGGGGTGGG - Intronic
930283883 2:49403911-49403933 CTGTGAAATGATTCAGTGGCAGG - Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
939243828 2:139597080-139597102 CAGTGTACAGAGGCTGAGGCAGG + Intergenic
942345891 2:175002758-175002780 TAGTGAAAAGAGTTAGAGGCAGG - Intronic
944648743 2:201807435-201807457 CAAAGTAAAGATTCAGTGCCTGG - Intronic
944735172 2:202556521-202556543 CAGTATACAGAGTAAGTGGAGGG + Exonic
944852509 2:203734603-203734625 CAATGTGAAGAGTCAGTAGTTGG + Intronic
944873543 2:203938357-203938379 AAGTGCAAAGAGCCTGTGGCAGG + Intronic
945874443 2:215263693-215263715 CAGTGTTAAGAGGCAGAGGTGGG - Intergenic
946624405 2:221595176-221595198 AAATGTAAAGAGTGAGTGGAAGG + Intergenic
946743658 2:222825250-222825272 CAGGGTAGAAACTCAGTGGCTGG + Intergenic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1172340146 20:34151074-34151096 ATGTGTAAAGACTCAGAGGCAGG + Intergenic
1172814912 20:37678673-37678695 CAGGGGAGAGAGGCAGTGGCAGG - Intergenic
1176265545 20:64207478-64207500 CCGTATAAAGAGTGAGTGGTAGG + Intronic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1178016038 21:28347120-28347142 CCTTGTAAAGAGTTATTGGCCGG + Intergenic
1178156591 21:29860825-29860847 CATTTGAAAGAGCCAGTGGCTGG + Intronic
1180038032 21:45260306-45260328 CAGTCTTGAGAGGCAGTGGCTGG - Intergenic
1181665389 22:24392124-24392146 CAGTGGAAAGAGCCTGGGGCTGG - Intronic
1182058771 22:27381899-27381921 CAAAGTGAAGAATCAGTGGCAGG + Intergenic
1184233930 22:43173118-43173140 CTGTGTACATAGTCAGAGGCTGG - Intronic
949484098 3:4520885-4520907 TAGTGTAAAGAGTTCCTGGCAGG + Intronic
949842634 3:8336621-8336643 CAGTGTGAAGAGTAAGTTGTAGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
953020834 3:39112096-39112118 CAGTGTAAACAGGCAATGACAGG + Intronic
954691391 3:52397423-52397445 CAGTGCAAAGGGCCTGTGGCAGG + Intronic
956092465 3:65682532-65682554 TAGTGTAAAGTGTGAGAGGCAGG - Intronic
957924965 3:86797118-86797140 CAGTGTAAGGAGTAAGTGAGAGG - Intergenic
961511280 3:127405300-127405322 CAGGGTAAAGAGCCACTGCCTGG - Intergenic
963380373 3:144522406-144522428 CAGTGAGAAGAGTCAGGTGCAGG + Intergenic
964673830 3:159255550-159255572 CAATGCAAAGTATCAGTGGCAGG + Intronic
966200260 3:177354447-177354469 CAGAGTAATGAGGCAGTAGCTGG + Intergenic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967512970 3:190334549-190334571 AAGTGGAAAGATTCAGTTGCTGG - Intronic
968752753 4:2398754-2398776 CAGTGCACAAGGTCAGTGGCAGG + Intronic
968752777 4:2398861-2398883 CAGTGCACAAGGTCAGTGGCAGG + Intronic
970422598 4:15919369-15919391 GTGTGTAAAGAGGCAGGGGCTGG + Intergenic
973084917 4:46046412-46046434 AATTGTAAAGAGTCAGTGCATGG - Intronic
974699780 4:65426287-65426309 AAGTGTAAAGGGTCTGAGGCAGG - Intronic
977043512 4:92042057-92042079 TAGTGTTGAGAGTCAGAGGCTGG + Intergenic
979354167 4:119683259-119683281 TAATGCAAAGATTCAGTGGCAGG - Intergenic
979464131 4:121016881-121016903 AAGTGGAAAGAGCCAGTGGTTGG + Intergenic
981200082 4:141970301-141970323 CTGTGAAAAAAGTCAGTGGTAGG - Intergenic
985548657 5:522408-522430 CAGTGTACAGAGTCAGAATCTGG - Intronic
989601220 5:43202448-43202470 AGGGGTAAAGAGACAGTGGCAGG - Intronic
989679036 5:44007677-44007699 CAGTGTTAAAAGTCAGTGGTGGG - Intergenic
990407020 5:55501798-55501820 CAATTTAAAAAGTTAGTGGCGGG - Intronic
990636787 5:57736937-57736959 CAGTGCAAAGTGACAGTGACAGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
992121561 5:73598855-73598877 CAAAGAAAGGAGTCAGTGGCTGG + Intergenic
994919123 5:106019440-106019462 GAGTGAAGAGAGTCAGTGGATGG + Intergenic
995631624 5:114140321-114140343 CAGTGAAATGTGTCAGAGGCTGG - Intergenic
995662763 5:114503817-114503839 CAGTGTGAAGGGGCACTGGCTGG - Intergenic
997061619 5:130511585-130511607 CAGAGTGAACAGTCAGTGGAAGG + Intergenic
997206082 5:132051006-132051028 CAGGGTCAGGAGTGAGTGGCAGG - Intergenic
997452374 5:133994518-133994540 GACTGGAAAGAGCCAGTGGCGGG - Intronic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002399145 5:178981552-178981574 CACGGTGAACAGTCAGTGGCAGG - Exonic
1002592290 5:180299133-180299155 CAGTGGAAATAGTCAGAGGGAGG - Intergenic
1004928700 6:20440914-20440936 CAGTGAAAAGGGTCAGGGGTAGG + Intronic
1005093806 6:22088516-22088538 CAGTGGAAAGAGTTTGGGGCTGG + Intergenic
1006219858 6:32479579-32479601 CAGTGTAGAGAGCCAGAGGCTGG - Intergenic
1008091386 6:47297050-47297072 CAGTTTAAAGACTCAGTCACAGG - Intronic
1008836401 6:55836795-55836817 CAGTGCAAAGAATCAGTGTTAGG + Intronic
1008955794 6:57214198-57214220 CACTGCAAAGAGTCAGTAGATGG - Intronic
1011025305 6:82862270-82862292 CAGTGTAATGAATCTGTGACAGG - Intergenic
1013799989 6:113931597-113931619 CCGTGCAAAGAGGCAGAGGCAGG - Intergenic
1015017037 6:128425778-128425800 CAGAGTGAAGAGTCAGTGGGTGG - Intronic
1015525291 6:134170269-134170291 CAGAGGAAAGAGTCCGTGGGAGG + Exonic
1016378808 6:143451315-143451337 CAGAGTTAAGAGTCGGTGACAGG - Intronic
1017832470 6:158142984-158143006 CAATGTATTGTGTCAGTGGCTGG - Intronic
1019531545 7:1506068-1506090 GAGTGGAAAGAGACCGTGGCGGG - Intergenic
1019838843 7:3418393-3418415 CACTGCAAAGAGTCACTGGCAGG + Intronic
1020489103 7:8757074-8757096 CAGTTTAAAAAGTCAGTTTCTGG - Intergenic
1021075149 7:16294258-16294280 CAGAGTGAAGTGTCAGTGGCTGG + Intronic
1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG + Exonic
1035223528 7:157420788-157420810 CAGTGTCTAGAGCCACTGGCTGG + Intergenic
1036116997 8:5969747-5969769 CAGTGTTGAGGCTCAGTGGCAGG - Intergenic
1037003834 8:13752204-13752226 GTCTGTAAAGAGTCAGGGGCTGG - Intergenic
1037406592 8:18549017-18549039 GAGTGTAATGAGTGAGTGTCTGG - Intronic
1037993172 8:23335162-23335184 CATTGTAAGGAGGCCGTGGCAGG + Intronic
1039479049 8:37858280-37858302 CATTGTAGAGAGACAGAGGCAGG - Intergenic
1040487708 8:47889527-47889549 CAGTGTCCTGAGTCAGGGGCGGG - Intronic
1040690830 8:49936641-49936663 AAGTGGAATGAGTAAGTGGCAGG - Intronic
1042585021 8:70327009-70327031 CAGTGAAGTGAGTTAGTGGCTGG - Intronic
1044391383 8:91656231-91656253 GATTGTAAAGAGTCAGTGGGAGG + Intergenic
1044928656 8:97231184-97231206 CATTTTAAAAAGACAGTGGCTGG + Intergenic
1045539896 8:103074246-103074268 CAGTGAAAACTGTCACTGGCTGG - Intergenic
1045753240 8:105511080-105511102 CAGTGGGAAGATTCAGTGGCTGG - Intronic
1046295733 8:112217402-112217424 CAGTATCAAGAGACAGTGGGGGG + Intergenic
1049362001 8:142216314-142216336 CAGTGCAGAGAGGCAGGGGCTGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050767796 9:9157069-9157091 CAGCATAAAGAATTAGTGGCCGG + Intronic
1053334664 9:37255861-37255883 CACTGTTAAGAATCTGTGGCTGG - Intronic
1053390558 9:37732430-37732452 AAGTATATAGAGTGAGTGGCAGG + Exonic
1057292435 9:93815255-93815277 CAGTGGAAAGGGGAAGTGGCAGG - Intergenic
1057606855 9:96504756-96504778 GAGGGTCAAGAGGCAGTGGCAGG + Intronic
1186495735 X:10011923-10011945 GAGTGTCCAGAGGCAGTGGCTGG + Intergenic
1186862975 X:13691363-13691385 AAGATTAAAGAGTGAGTGGCTGG + Intronic
1186984373 X:14996012-14996034 CAGAGGAAAGAGTCAGTGAATGG - Intergenic
1187265232 X:17726072-17726094 CAGTGTGAAGAGCCAGTGAGTGG - Exonic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193139905 X:78016833-78016855 CAGTGAAAGCAGCCAGTGGCAGG - Intronic
1193524887 X:82576857-82576879 CTGTGAAAAAAGTCAGTGGTAGG + Intergenic
1197020498 X:121682085-121682107 CAGAGAAATGAGTCAGTAGCTGG + Intergenic
1198632126 X:138652160-138652182 CAGTTCAAAGAGTCAGAGGTGGG - Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1200239177 X:154484930-154484952 CACTGTATAGAGTCCATGGCTGG + Exonic