ID: 1110792076

View in Genome Browser
Species Human (GRCh38)
Location 13:79597600-79597622
Sequence GGGAAATGAGCAATTTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110792076_1110792079 -5 Left 1110792076 13:79597600-79597622 CCATGATAAATTGCTCATTTCCC No data
Right 1110792079 13:79597618-79597640 TTCCCCAGATAAATAGGTATGGG No data
1110792076_1110792080 -4 Left 1110792076 13:79597600-79597622 CCATGATAAATTGCTCATTTCCC No data
Right 1110792080 13:79597619-79597641 TCCCCAGATAAATAGGTATGGGG No data
1110792076_1110792078 -6 Left 1110792076 13:79597600-79597622 CCATGATAAATTGCTCATTTCCC No data
Right 1110792078 13:79597617-79597639 TTTCCCCAGATAAATAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110792076 Original CRISPR GGGAAATGAGCAATTTATCA TGG (reversed) Intergenic
No off target data available for this crispr