ID: 1110792194

View in Genome Browser
Species Human (GRCh38)
Location 13:79598840-79598862
Sequence CTGTGGTTGAAGAAATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110792194_1110792197 3 Left 1110792194 13:79598840-79598862 CCTGGTCATTTCTTCAACCACAG No data
Right 1110792197 13:79598866-79598888 CTTGCACAGTGCCTGCCACCTGG No data
1110792194_1110792198 7 Left 1110792194 13:79598840-79598862 CCTGGTCATTTCTTCAACCACAG No data
Right 1110792198 13:79598870-79598892 CACAGTGCCTGCCACCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110792194 Original CRISPR CTGTGGTTGAAGAAATGACC AGG (reversed) Intergenic
No off target data available for this crispr