ID: 1110797091

View in Genome Browser
Species Human (GRCh38)
Location 13:79652263-79652285
Sequence CCTACTGTTGCATACTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797091_1110797093 -9 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797093 13:79652277-79652299 AACAGTAGGTTCAAGTTCCCAGG No data
1110797091_1110797097 22 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data
1110797091_1110797098 27 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797098 13:79652313-79652335 AGATATATCCCCTTAGGGCCTGG No data
1110797091_1110797099 28 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797099 13:79652314-79652336 GATATATCCCCTTAGGGCCTGGG No data
1110797091_1110797096 21 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797096 13:79652307-79652329 TCTATCAGATATATCCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797091 Original CRISPR CCTACTGTTGCATACTTTTA TGG (reversed) Intergenic