ID: 1110797094

View in Genome Browser
Species Human (GRCh38)
Location 13:79652294-79652316
Sequence ATCTGATAGAGAAATTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797094_1110797100 3 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797100 13:79652320-79652342 TCCCCTTAGGGCCTGGGTAAAGG No data
1110797094_1110797098 -4 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797098 13:79652313-79652335 AGATATATCCCCTTAGGGCCTGG No data
1110797094_1110797096 -10 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797096 13:79652307-79652329 TCTATCAGATATATCCCCTTAGG No data
1110797094_1110797099 -3 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797099 13:79652314-79652336 GATATATCCCCTTAGGGCCTGGG No data
1110797094_1110797097 -9 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797094 Original CRISPR ATCTGATAGAGAAATTACCT GGG (reversed) Intergenic
No off target data available for this crispr