ID: 1110797095

View in Genome Browser
Species Human (GRCh38)
Location 13:79652295-79652317
Sequence TATCTGATAGAGAAATTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797095_1110797099 -4 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797099 13:79652314-79652336 GATATATCCCCTTAGGGCCTGGG No data
1110797095_1110797097 -10 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data
1110797095_1110797098 -5 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797098 13:79652313-79652335 AGATATATCCCCTTAGGGCCTGG No data
1110797095_1110797100 2 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797100 13:79652320-79652342 TCCCCTTAGGGCCTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797095 Original CRISPR TATCTGATAGAGAAATTACC TGG (reversed) Intergenic