ID: 1110797096

View in Genome Browser
Species Human (GRCh38)
Location 13:79652307-79652329
Sequence TCTATCAGATATATCCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797094_1110797096 -10 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797096 13:79652307-79652329 TCTATCAGATATATCCCCTTAGG No data
1110797091_1110797096 21 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797096 13:79652307-79652329 TCTATCAGATATATCCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797096 Original CRISPR TCTATCAGATATATCCCCTT AGG Intergenic