ID: 1110797097

View in Genome Browser
Species Human (GRCh38)
Location 13:79652308-79652330
Sequence CTATCAGATATATCCCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797094_1110797097 -9 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data
1110797091_1110797097 22 Left 1110797091 13:79652263-79652285 CCATAAAAGTATGCAACAGTAGG No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data
1110797095_1110797097 -10 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797097 13:79652308-79652330 CTATCAGATATATCCCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797097 Original CRISPR CTATCAGATATATCCCCTTA GGG Intergenic
No off target data available for this crispr