ID: 1110797100

View in Genome Browser
Species Human (GRCh38)
Location 13:79652320-79652342
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110797094_1110797100 3 Left 1110797094 13:79652294-79652316 CCCAGGTAATTTCTCTATCAGAT No data
Right 1110797100 13:79652320-79652342 TCCCCTTAGGGCCTGGGTAAAGG No data
1110797095_1110797100 2 Left 1110797095 13:79652295-79652317 CCAGGTAATTTCTCTATCAGATA No data
Right 1110797100 13:79652320-79652342 TCCCCTTAGGGCCTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110797100 Original CRISPR TCCCCTTAGGGCCTGGGTAA AGG Intergenic