ID: 1110802929

View in Genome Browser
Species Human (GRCh38)
Location 13:79721304-79721326
Sequence TCTTATAAGGGGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110802924_1110802929 -3 Left 1110802924 13:79721284-79721306 CCTGAATTAATCACAAGGGTTCT No data
Right 1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110802929 Original CRISPR TCTTATAAGGGGAAGGCAGA AGG Intergenic
No off target data available for this crispr