ID: 1110809429

View in Genome Browser
Species Human (GRCh38)
Location 13:79795119-79795141
Sequence AGCTCTGTATGGAATGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110809427_1110809429 -8 Left 1110809427 13:79795104-79795126 CCAGGACAGTTTTATAGCTCTGT No data
Right 1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG No data
1110809426_1110809429 -7 Left 1110809426 13:79795103-79795125 CCCAGGACAGTTTTATAGCTCTG No data
Right 1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG No data
1110809425_1110809429 4 Left 1110809425 13:79795092-79795114 CCTCAGCATGTCCCAGGACAGTT No data
Right 1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG No data
1110809422_1110809429 28 Left 1110809422 13:79795068-79795090 CCTTTGAAACATCTTTAGGCTCC No data
Right 1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG No data
1110809424_1110809429 7 Left 1110809424 13:79795089-79795111 CCTCCTCAGCATGTCCCAGGACA No data
Right 1110809429 13:79795119-79795141 AGCTCTGTATGGAATGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110809429 Original CRISPR AGCTCTGTATGGAATGCAGA TGG Intergenic
No off target data available for this crispr