ID: 1110816643

View in Genome Browser
Species Human (GRCh38)
Location 13:79867678-79867700
Sequence CCTACTCAGTAAAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110816639_1110816643 -5 Left 1110816639 13:79867660-79867682 CCATAATGATCCTCTTCGCCTAC No data
Right 1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG No data
1110816638_1110816643 2 Left 1110816638 13:79867653-79867675 CCTCTGACCATAATGATCCTCTT No data
Right 1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110816643 Original CRISPR CCTACTCAGTAAAAGGAGAA TGG Intergenic
No off target data available for this crispr