ID: 1110817772

View in Genome Browser
Species Human (GRCh38)
Location 13:79880611-79880633
Sequence GTCAGTTACTGCTTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110817772_1110817774 -1 Left 1110817772 13:79880611-79880633 CCATCCATCAAGCAGTAACTGAC No data
Right 1110817774 13:79880633-79880655 CTACCTTTGATGTGCCCAGCAGG No data
1110817772_1110817779 25 Left 1110817772 13:79880611-79880633 CCATCCATCAAGCAGTAACTGAC No data
Right 1110817779 13:79880659-79880681 AACTTATCCATTAAGCACTAAGG No data
1110817772_1110817775 0 Left 1110817772 13:79880611-79880633 CCATCCATCAAGCAGTAACTGAC No data
Right 1110817775 13:79880634-79880656 TACCTTTGATGTGCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110817772 Original CRISPR GTCAGTTACTGCTTGATGGA TGG (reversed) Intergenic
No off target data available for this crispr