ID: 1110820580

View in Genome Browser
Species Human (GRCh38)
Location 13:79910596-79910618
Sequence CTGTTGTTCTTAAAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110820580_1110820583 16 Left 1110820580 13:79910596-79910618 CCCTGGGGCTTTAAGAACAACAG No data
Right 1110820583 13:79910635-79910657 CATTTCTAAGACTTGTAAGTAGG No data
1110820580_1110820582 -7 Left 1110820580 13:79910596-79910618 CCCTGGGGCTTTAAGAACAACAG No data
Right 1110820582 13:79910612-79910634 ACAACAGTAACAAACTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110820580 Original CRISPR CTGTTGTTCTTAAAGCCCCA GGG (reversed) Intergenic
No off target data available for this crispr