ID: 1110830767

View in Genome Browser
Species Human (GRCh38)
Location 13:80028252-80028274
Sequence ATGATGTAATTAATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110830767_1110830769 0 Left 1110830767 13:80028252-80028274 CCATGTTCCATTAATTACATCAT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1110830769 13:80028275-80028297 GCTGCCAATAATTTTACTTCTGG 0: 1
1: 0
2: 2
3: 24
4: 182
1110830767_1110830771 29 Left 1110830767 13:80028252-80028274 CCATGTTCCATTAATTACATCAT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1110830771 13:80028304-80028326 GTGTCCTTCCTGATAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110830767 Original CRISPR ATGATGTAATTAATGGAACA TGG (reversed) Intergenic
900860922 1:5230015-5230037 ATGTTGTATTTAATGGAAGGTGG - Intergenic
902560417 1:17273814-17273836 AGCATGTAAGTAACGGAACAGGG - Intronic
903481880 1:23659661-23659683 ATGATAGAATTAATAGAAAAGGG - Intergenic
905682892 1:39886920-39886942 ATGATGCAATTAAAGGAAAAGGG + Intergenic
906018986 1:42610037-42610059 GGGATTTAATTACTGGAACAAGG - Intronic
906934139 1:50196970-50196992 ATGATTTAGTTAATGTAGCAAGG + Intronic
910135933 1:83969839-83969861 AAGATGTAATTATTTGAACAAGG + Intronic
912171921 1:107111146-107111168 ATCATGTAATTACTGGGATAAGG - Intergenic
912573932 1:110646890-110646912 AAGATATAATTAATGTAACTTGG - Intergenic
912732203 1:112117657-112117679 ATGATGAAATTAAAATAACATGG + Intergenic
913366045 1:118040018-118040040 ATGATATAATTAATGTTAAATGG + Intronic
914453495 1:147814175-147814197 ATGATGGAATTTATGGCAAAGGG - Intergenic
915896125 1:159812425-159812447 ATGATGGTGTTACTGGAACAAGG + Intronic
916666730 1:166974203-166974225 ATGATGGAAGAAATGGAAAAAGG - Intronic
917179657 1:172282231-172282253 ATGATGTAATTAACTGAGAAAGG - Intronic
918899320 1:190392023-190392045 ATGATGTTAAAAACGGAACAAGG + Intronic
920442159 1:205988634-205988656 ATAATGGAAATAATGGAACAAGG - Intronic
920673150 1:208020177-208020199 ATGATGGAATGAATGGAACTTGG - Intergenic
921403785 1:214756432-214756454 ATCATGTAGTCAATGAAACATGG - Intergenic
921935998 1:220797656-220797678 ATGGTGGAATGAAGGGAACAAGG - Intronic
923228836 1:231964505-231964527 ATGGTGTAAACAATGGAACAGGG + Intronic
923308091 1:232706860-232706882 ATAAAATAATTAATGGTACAAGG - Intergenic
923960205 1:239072545-239072567 ATGAAGTAAATAATGCAGCATGG + Intergenic
924200772 1:241656292-241656314 AGAATGTTTTTAATGGAACAGGG + Intronic
924490654 1:244534763-244534785 ATGAAGTAAGTAAGGCAACAGGG - Intronic
1062784658 10:252978-253000 ATGATTGAATTTAGGGAACAGGG + Exonic
1063242866 10:4189240-4189262 ATGAGGTAATCAATGGATCTAGG - Intergenic
1063523498 10:6761716-6761738 ACGATGTAATCAATGTCACAGGG - Intergenic
1063863330 10:10336551-10336573 ATGATGAAATCAATGTAACTAGG - Intergenic
1064820804 10:19329869-19329891 ATGATTTGATTATTTGAACAAGG + Intronic
1065117117 10:22493801-22493823 CTCATGTAATTTATTGAACATGG - Intergenic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1068978626 10:63037494-63037516 ATTATGTTATAAATGGAAGAGGG + Intergenic
1069217034 10:65833593-65833615 ATGTTTTAATTAATGAAATATGG + Intergenic
1071042501 10:81330673-81330695 ATGATGTATTTTAAGGAATAGGG - Intergenic
1071803010 10:89085784-89085806 ATGAAGTAATTAATGGAGTAAGG + Intergenic
1073227644 10:101937097-101937119 ATGATGTATTGAAAGGAATATGG - Intronic
1074269056 10:111934927-111934949 ATGATGTAACAAATAAAACAGGG - Intergenic
1074342630 10:112648484-112648506 ATGATTTAATTAATTTATCATGG - Intronic
1075290321 10:121224275-121224297 ATAGTATAATTATTGGAACAAGG - Intergenic
1076945280 10:133643812-133643834 ATGATGTCTTTTATGGATCAGGG + Intergenic
1079701061 11:23549281-23549303 ATTATATGATAAATGGAACATGG - Intergenic
1080235726 11:30066369-30066391 AAGATGAAATTAATGAAATAAGG - Intergenic
1080370820 11:31640506-31640528 ATAATGTAATTAATAGGAAAGGG - Intronic
1086665648 11:89478441-89478463 ATGATGTCATGAAAAGAACATGG - Intronic
1087948940 11:104196264-104196286 ATGATGTAACTAAAGGAGAATGG - Intergenic
1090899543 11:131015532-131015554 ATTATATTATTAATGGAAGAAGG + Intergenic
1090994017 11:131848810-131848832 ATGATGTAATTAAAAGATCAGGG - Intronic
1093782615 12:23154596-23154618 ATTTTGTAACTAATGGAAGATGG + Intergenic
1094590284 12:31813163-31813185 ATGATAAAATTGATGGAACTTGG - Intergenic
1095376022 12:41529960-41529982 TTGAGGTAATTGTTGGAACATGG - Intronic
1095552042 12:43454472-43454494 CTGATGAAAGTAAAGGAACAAGG - Intronic
1097789411 12:63798284-63798306 AGGAAGTAATGCATGGAACAAGG - Intronic
1097961897 12:65539904-65539926 ATTATGTCATAAATGTAACAGGG - Intergenic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098262985 12:68690182-68690204 AGTATGTAAATAATGGAACTGGG - Intronic
1098262990 12:68690234-68690256 AGTATGTAAATAATGGAACTGGG + Intronic
1098677026 12:73302446-73302468 ATGATGTAATGAATGAAAGATGG + Intergenic
1099153097 12:79139993-79140015 ATCCTGAAATTAATGGAACAGGG + Intronic
1099895238 12:88637592-88637614 AAAATGAAATTAATGGATCAAGG - Intergenic
1100232675 12:92624847-92624869 AAGAGGTAATTAAGGTAACATGG + Intergenic
1103247528 12:119470806-119470828 ATGATGTCAATAATAGCACAGGG - Intronic
1103298888 12:119911990-119912012 ATGATGTAAATAAAGGTACCAGG + Intergenic
1103513879 12:121494237-121494259 ATGAAGCAATTAAAGGAAAAGGG + Intronic
1106995696 13:35477735-35477757 GTGATTTAATTAAGGGAAAATGG + Intronic
1107061455 13:36163862-36163884 ATGATGTAATTCACGCTACAAGG - Intergenic
1108422867 13:50268359-50268381 AAGCTGTTATTAATAGAACATGG - Intronic
1109099942 13:58170714-58170736 ATGAATTAATTAATGTTACAGGG + Intergenic
1109465205 13:62722773-62722795 AGGGTGAAATTAATGGAAAAGGG - Intergenic
1109528647 13:63609715-63609737 ACTCTGTAATTAATGGACCAGGG - Intergenic
1109666265 13:65542710-65542732 ATTATGTGATAAATAGAACATGG + Intergenic
1110135225 13:72059606-72059628 ATGAAGTAAGTAATGCAGCAGGG + Intergenic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111056731 13:82960075-82960097 ATGTTGTAATCAATTAAACAAGG + Intergenic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1114989041 14:28264387-28264409 ACGTTGTAAATAAAGGAACACGG + Intergenic
1116016874 14:39417932-39417954 ATGATATAATCAATGGAAAAAGG + Intronic
1116027746 14:39535577-39535599 ATCAGGAAATTAATGTAACAAGG - Intergenic
1120319605 14:82942341-82942363 TTGATCTAATTAATGGGTCATGG + Intergenic
1120416820 14:84229851-84229873 ATGATGTAATTAATGTTAAGTGG - Intergenic
1120532558 14:85650267-85650289 ATGAATGAATTAAAGGAACATGG - Exonic
1120697597 14:87660775-87660797 ATGAAATAAGTAATGCAACAGGG + Intergenic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1126863931 15:52916745-52916767 ATCATGTAATTAATACAACACGG + Intergenic
1127137944 15:55944006-55944028 AAGATGTAATGATTGGAAGATGG + Intronic
1131539616 15:93265347-93265369 ATGATGTAATTAATTTAATGCGG + Intergenic
1132088935 15:98931938-98931960 ATGATGGAATTGATAGAACAAGG + Intronic
1133542524 16:6770321-6770343 ATAATGTATTTAATGCAACAGGG + Intronic
1134395444 16:13858337-13858359 ATGTGCTAATTAATTGAACATGG + Intergenic
1135828272 16:25749717-25749739 ATGATGTAATACATGTAAAATGG + Intronic
1136864436 16:33733360-33733382 AATATGTATTTAATAGAACATGG + Intergenic
1138813336 16:60176166-60176188 ATGTTGTTACTAATGGAAGAAGG - Intergenic
1139006612 16:62578987-62579009 AGGATGTAATTCTTTGAACATGG + Intergenic
1139077729 16:63473951-63473973 ATGAAATAATTAATGAATCAAGG + Intergenic
1139560598 16:67739265-67739287 ATGAAGTAATGGATGGAAAAGGG - Intronic
1203125925 16_KI270728v1_random:1581486-1581508 AATATGTATTTAATAGAACATGG + Intergenic
1149111953 17:53045186-53045208 ATGAGTTAATTAGTGGAATATGG - Intergenic
1149507695 17:57209180-57209202 ATGGTGCAATGAATAGAACAAGG - Intergenic
1151117004 17:71747808-71747830 TTGAAATAATCAATGGAACATGG - Intergenic
1153540487 18:6148914-6148936 ATAATGAAAAAAATGGAACAGGG - Intronic
1155559067 18:27055789-27055811 ATGATATAACAAAAGGAACACGG + Intronic
1156159776 18:34345665-34345687 ATAATGTAATGAATGGAATTTGG - Intergenic
1156747628 18:40411679-40411701 ATAATCTAATCAAGGGAACAGGG - Intergenic
1157485866 18:48086447-48086469 ATGATCTAGATTATGGAACATGG - Intronic
1159212257 18:65340250-65340272 ATGAGGAAACTAATAGAACATGG - Intergenic
1160249548 18:77189624-77189646 ATGATGAATTTAATGTAAAATGG - Intergenic
1160290098 18:77584539-77584561 ATGAGGTTATGAATGGAACAAGG + Intergenic
1164871004 19:31642797-31642819 AGGATGTAATAAATGGAAAGGGG + Intergenic
1166363550 19:42267162-42267184 ATTATATAAATAATGTAACAGGG + Intergenic
926149764 2:10418833-10418855 ATGATGTTCTGAATGGAACCAGG - Intronic
926384541 2:12323402-12323424 AGGATGCTGTTAATGGAACAGGG + Intergenic
926484620 2:13439155-13439177 ATGAAGTGGTTAATGGAGCATGG - Intergenic
926613945 2:14976131-14976153 ATGAAGTAATAACTGGAACACGG + Intergenic
928676490 2:33656310-33656332 ACGTTGTGATTAATGGAAAAAGG + Intergenic
928909052 2:36400318-36400340 ATGATGTAGTTGATTGAAGAGGG + Intronic
930829129 2:55724623-55724645 GTGATGAAATTAAGGAAACATGG + Intergenic
931390641 2:61840532-61840554 ATGATGTCATTAATGAGACAGGG + Exonic
931991319 2:67793269-67793291 ATGATGTAATCACGGGCACAGGG + Intergenic
934632746 2:95947080-95947102 AATATGTATTTAATAGAACATGG + Intronic
934800754 2:97156177-97156199 AATATGTATTTAATAGAACATGG - Intronic
934999297 2:98996705-98996727 GTTCTGTAATTAATGGCACAAGG + Intergenic
935762548 2:106334730-106334752 GTGATGGACTTCATGGAACAAGG - Intergenic
938956798 2:136306471-136306493 AAGATGTAGTGAATGGAAGAAGG - Intergenic
939759762 2:146160189-146160211 ATGATTTGACTAATGGAAAATGG - Intergenic
940035310 2:149306587-149306609 GTGAAGAAATTAATGCAACAGGG + Intergenic
940657360 2:156504596-156504618 ATGATATAATTAAAGATACAAGG + Intronic
940992693 2:160114180-160114202 GTGAAGTAATTAAAGCAACATGG - Intronic
941056338 2:160793477-160793499 ATTATGTAATTCAAAGAACAAGG + Intergenic
941464001 2:165803518-165803540 ATGATGTAGTTTATAGAGCATGG - Intergenic
941501046 2:166276624-166276646 ATGAAGTTAATAATGGACCAAGG - Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
942904103 2:181160251-181160273 ATGACTTAATTAATGTTACAAGG - Intergenic
943857973 2:192823559-192823581 ATGATGAAATAAATGAAAGAGGG + Intergenic
947094984 2:226556064-226556086 GTGGAGTAATTGATGGAACAAGG + Intergenic
947407462 2:229794409-229794431 ATAAAAAAATTAATGGAACATGG + Intronic
947997248 2:234538633-234538655 ATGTTGTAATAAATGGAAGTGGG - Intergenic
948325140 2:237111910-237111932 ATGAAGTCAATATTGGAACAAGG + Intergenic
949087786 2:242171410-242171432 ATGGTATAAATAATGAAACAAGG + Intergenic
1174896548 20:54455454-54455476 ATGATGTATTTTAATGAACAGGG - Intergenic
1175048900 20:56134548-56134570 TTGATTTAATTAATGGCAAAAGG + Intergenic
1177518362 21:22184141-22184163 ATGATGTAATACATGGTAGAAGG - Intergenic
1177699392 21:24616267-24616289 TTGCTGTAATTAATGTGACAGGG - Intergenic
1178691384 21:34752946-34752968 AAGATGAAATGACTGGAACAAGG + Intergenic
1179369143 21:40788099-40788121 ATGAAGTAATTCTTGGAAGAGGG - Intronic
1184399712 22:44266888-44266910 ATAATCTAAATAATGAAACATGG + Intronic
949565579 3:5241904-5241926 TTGATGGAATTAATGGACTATGG + Intergenic
950432193 3:12957266-12957288 ATGAAGAAAGTAAAGGAACAAGG - Intronic
950981058 3:17304712-17304734 TAGATCTAATTCATGGAACAGGG + Intronic
952090833 3:29883434-29883456 ATGATGTACATGAAGGAACAAGG + Intronic
952942984 3:38457432-38457454 ATGGTGTAATAAATGTCACATGG + Intronic
955512448 3:59694996-59695018 ATGTGGTAAGTAATGGAACCAGG - Intergenic
956528975 3:70196336-70196358 CTGTTGTAATTACAGGAACATGG + Intergenic
957225261 3:77435012-77435034 TTGATGTAATTGAAGGAAAATGG + Intronic
959094624 3:101940487-101940509 ATGAGGTAATTATTGGAATTCGG + Intergenic
959758457 3:109927858-109927880 ATGATTAAATGAATGGAAGATGG + Intergenic
961081266 3:124031011-124031033 ATGCAGTAATTAATAGAATAAGG - Intergenic
963222288 3:142825742-142825764 ATGATTGAAATAATGGACCATGG - Intronic
963425659 3:145119203-145119225 ATAATGTAATTAAAGGGACAAGG + Intergenic
963938541 3:151078523-151078545 ATGATGAACTAAATGTAACAGGG - Intergenic
965425189 3:168514228-168514250 ATAATGTAATCACTGGAACCTGG + Intergenic
970102821 4:12544815-12544837 AGGTTGTAATTAATGGCCCAGGG + Intergenic
973005814 4:45005551-45005573 ATGTTGGAATTAATGAGACAAGG - Intergenic
974231934 4:59127250-59127272 GTGATGTATTTAATGGAGAAGGG - Intergenic
975568393 4:75785660-75785682 ATGATGTAAATAAAGAAAAAGGG - Intronic
975687324 4:76930268-76930290 ATCATATAAGTAATGGATCATGG + Intergenic
976383927 4:84433778-84433800 ATGATGTAATTAATTATAGATGG + Intergenic
976728347 4:88238917-88238939 ATGAACTAAATAAGGGAACAGGG - Intergenic
978312462 4:107399653-107399675 ATGATTTAATAAGAGGAACAAGG - Intergenic
978838351 4:113180742-113180764 TTCATGGAATTAATGGAACATGG + Intronic
979298395 4:119058318-119058340 AGGAAGAAATTAATGGAATATGG + Exonic
979324612 4:119364393-119364415 ATGGTGCAATTCCTGGAACAGGG + Intergenic
980165589 4:129222961-129222983 ATGATGTATTTAATTCCACATGG + Intergenic
981090085 4:140723217-140723239 ATGATCTAAGTTGTGGAACATGG - Intronic
981482211 4:145250518-145250540 ATGATGTGGTTATTAGAACAGGG - Intergenic
982438549 4:155405991-155406013 ATAATGTAATTCTTGGTACATGG + Intergenic
982986892 4:162221191-162221213 AGGATGAAACAAATGGAACAGGG + Intergenic
983180070 4:164637371-164637393 ATAATGTAATGAAATGAACATGG - Intergenic
983242451 4:165249093-165249115 ATGGTGCAATTCCTGGAACAGGG + Intronic
983304818 4:165972622-165972644 ATGAGATAGTTAATAGAACATGG - Intronic
983973401 4:173901808-173901830 ATGAGGTAATTCATCCAACATGG + Intergenic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
985167923 4:187117238-187117260 ATGAAGTAATTCTAGGAACATGG + Intergenic
985284101 4:188317126-188317148 ATTATATAATTAATGGAAGAGGG - Intergenic
985448662 4:190044328-190044350 ATGATGTCTTTTATGGATCAGGG + Intergenic
989394965 5:40944918-40944940 ATGCTGACATTAAAGGAACATGG + Intronic
990264288 5:54058999-54059021 ATGTTGTGACAAATGGAACAAGG - Intronic
990497773 5:56366076-56366098 ATGGGAGAATTAATGGAACAGGG - Intergenic
991422151 5:66452684-66452706 CTAATGTAATTAATTGTACATGG - Intergenic
991552429 5:67855063-67855085 TTCATGTGATTAATGGAATATGG + Intergenic
992336539 5:75776083-75776105 ATGAAGCAATTAATAAAACAAGG - Intergenic
994811988 5:104531533-104531555 ATGATGAAATAAATGCAATAAGG - Intergenic
995054009 5:107739133-107739155 AAGATGTATTTCATGGAACTGGG + Intergenic
996080926 5:119256894-119256916 ATAATGGAATTAATAGAAAAGGG + Intergenic
996151397 5:120040228-120040250 AAGATGCAATTTCTGGAACAAGG - Intergenic
997799412 5:136844689-136844711 AAGATGTAATTAGTGGATTAGGG - Intergenic
998677216 5:144423261-144423283 AGGATTTTATTAAGGGAACATGG + Intronic
1001065932 5:168535127-168535149 AAGTGCTAATTAATGGAACATGG - Intergenic
1001911958 5:175527756-175527778 ATGATGTAAACAGTGGTACATGG - Exonic
1002826701 6:780682-780704 TGGATGTAGTTAATGGCACATGG - Intergenic
1004041516 6:11982652-11982674 AAGATGTAATTTGTGGAATATGG + Intergenic
1004249615 6:14012751-14012773 ATGGTGGAATCATTGGAACATGG + Intergenic
1004609434 6:17225423-17225445 ATGATATAATAAATGGACCCAGG - Intergenic
1005802164 6:29437794-29437816 ATGATGCCATTAATGTTACAGGG - Intronic
1008207562 6:48681716-48681738 ATGATGGAATTAATGTCACTAGG - Intergenic
1008316981 6:50055900-50055922 ATGATGAAATTAATTAAAGATGG + Intergenic
1009774394 6:68186921-68186943 AAGATGTGATTGATGGAGCAAGG + Intergenic
1010573496 6:77506202-77506224 ATGATGTAAATAATAACACATGG - Intergenic
1010602050 6:77841113-77841135 ATAATGTAATAAAAGCAACATGG - Intronic
1012894036 6:104928647-104928669 TGGATGTTATTAATGGCACATGG - Intergenic
1013435504 6:110101693-110101715 ATGGAGGCATTAATGGAACATGG + Exonic
1013946880 6:115732085-115732107 ATGAGGTAATTAATTGTAGATGG - Intergenic
1014061008 6:117072123-117072145 ATGATGTGATGAATGCAACAGGG - Intergenic
1015003220 6:128245756-128245778 ATTTTGTAAATACTGGAACAAGG + Intronic
1015095742 6:129413222-129413244 ATGATAGAATAAAAGGAACAAGG + Intronic
1015389496 6:132665152-132665174 AAGATGTATTTGATGGAGCATGG + Intergenic
1015491106 6:133826580-133826602 ATTTTGTAATAAATGAAACAGGG - Intergenic
1017225057 6:152011582-152011604 CTGGTGAAATTAATGCAACAGGG - Intronic
1017399734 6:154046475-154046497 AACATGAAATTAATGGAAAAGGG - Intronic
1017722399 6:157253078-157253100 ATGATGTGATACTTGGAACATGG + Intergenic
1019982325 7:4630552-4630574 AAGCTGGAATTCATGGAACATGG - Intergenic
1024142822 7:46479715-46479737 ATTAAATAATTAATGGAAAATGG - Intergenic
1026548154 7:71342658-71342680 ATGGTATAATTATTGGAAGAAGG + Intronic
1027362175 7:77420781-77420803 CTGATTTAATCAAAGGAACAAGG + Intergenic
1028807455 7:95044968-95044990 ATGATGAAAATAATAGAAAATGG + Intronic
1030745784 7:113164412-113164434 AAGATGTAATTAATTAAAAAGGG + Intergenic
1031678552 7:124641707-124641729 AGGAAGTAAATAATGGATCAGGG - Intergenic
1036996139 8:13659037-13659059 ATTATGTAATTTAATGAACAGGG + Intergenic
1037312031 8:17566165-17566187 ATTAAGTAAGTAATGGAAAAAGG - Exonic
1038200289 8:25406420-25406442 ATGATGTAATTATTGTATTATGG - Intronic
1039842225 8:41302420-41302442 ATGTTTTCATTAATCGAACATGG - Intronic
1040618130 8:49060897-49060919 ATGATGTAATTGATGAAGAAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041367148 8:57118786-57118808 ATGATGAAATTAATTTAAAAGGG - Intergenic
1041850947 8:62391672-62391694 ATGATATAAGTAAGGGAAAATGG + Intronic
1042079616 8:65037035-65037057 AGGATATAATTGATGGAACAAGG - Intergenic
1043052323 8:75399151-75399173 ATACTGTAATTGATAGAACAAGG + Intergenic
1043456441 8:80416776-80416798 TTAATGTAATTAGTGGTACAAGG - Intergenic
1043742104 8:83827201-83827223 AAGATGTAATTAATGGAAAAAGG + Intergenic
1044029479 8:87216751-87216773 AAAATGTAATTCATGGAAAAGGG - Intronic
1044681148 8:94778806-94778828 ATGATGTAATCAAAGGGACTGGG + Intronic
1044701009 8:94965241-94965263 ATGATATAATTAAAGGACCGGGG + Intronic
1045755037 8:105532744-105532766 ATGATGTAATTGGGGGTACAAGG + Intronic
1045961706 8:107976293-107976315 ATGGTTTAATTAAAGAAACATGG + Intronic
1046319966 8:112559810-112559832 ATGATGTAATAAATACACCAAGG + Intronic
1046525725 8:115380113-115380135 ATTATGAAATTAATGGAAGTAGG + Intergenic
1047164102 8:122417541-122417563 ATGATGTATCTAATTGAAGAGGG + Intergenic
1048723694 8:137357807-137357829 TTGAGATAATTAATAGAACAGGG + Intergenic
1049171134 8:141161368-141161390 ATGCTGTAATTAGTGGAATGAGG - Intronic
1050659684 9:7870121-7870143 ATGATATAATTAAAAGAACATGG + Intronic
1053450160 9:38187020-38187042 ATGCTGCACTTAATGGATCAGGG + Intergenic
1055374619 9:75635660-75635682 GAGATGTAATGTATGGAACAGGG + Intergenic
1055410000 9:76018753-76018775 GTGATGCAATAAATGGAATAAGG + Intronic
1059986672 9:119826911-119826933 GTGCTGTAAATAAGGGAACAGGG - Intergenic
1060671753 9:125475956-125475978 ATGATGGAATTAATGGGAGTCGG - Intronic
1185937213 X:4271351-4271373 ATGATGAAATGAATGTGACAAGG + Intergenic
1186440568 X:9582280-9582302 AAGATCTAATTTATGTAACATGG - Intronic
1187542118 X:20207085-20207107 ATCATGTAAATAATGGATCAAGG + Intronic
1188345696 X:29062548-29062570 AAGTAGTAATTAATGGTACATGG + Intronic
1196097024 X:111811207-111811229 AGGATGTAATTTCTGGAATACGG - Intronic
1196321394 X:114344608-114344630 ATGATGTTATGCATGGAAAAAGG - Intergenic
1196997089 X:121396008-121396030 TTGATGTGATTAATGGAAATAGG + Intergenic
1198370872 X:135987516-135987538 ATGTGGTAATTAAAGGTACAAGG + Intronic
1199001843 X:142648181-142648203 ATGATGTTATACATGGAAAATGG - Intergenic
1199052369 X:143252015-143252037 AAGAAGGAATGAATGGAACAAGG + Intergenic
1200758051 Y:7010067-7010089 ATCCTAAAATTAATGGAACATGG + Intronic
1201788852 Y:17815906-17815928 ATGTTACAATTGATGGAACAAGG + Intergenic
1201812701 Y:18090081-18090103 ATGTTACAATTGATGGAACAAGG - Intergenic
1201859385 Y:18579106-18579128 CTGAGGAAATTAATGGAACACGG - Intronic
1201873936 Y:18741275-18741297 CTGAGGAAATTAATGGAACACGG + Intronic
1202167645 Y:22008560-22008582 CTGAGGAAATTAATGGGACACGG + Intergenic
1202223715 Y:22577809-22577831 CTGAGGAAATTAATGGGACACGG - Intergenic
1202319401 Y:23617852-23617874 CTGAGGAAATTAATGGGACACGG + Intergenic
1202350466 Y:23984975-23984997 ATGTTGCAACTGATGGAACAAGG + Intergenic
1202520313 Y:25685146-25685168 ATGTTGCAACTGATGGAACAAGG - Intergenic
1202551368 Y:26052205-26052227 CTGAGGAAATTAATGGGACACGG - Intergenic