ID: 1110833349

View in Genome Browser
Species Human (GRCh38)
Location 13:80056867-80056889
Sequence CAAGGTAAACATGGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110833349_1110833359 1 Left 1110833349 13:80056867-80056889 CCTGCATCCCCATGTTTACCTTG No data
Right 1110833359 13:80056891-80056913 GGTTTCTAGAGGTTCCTCCTGGG No data
1110833349_1110833356 -10 Left 1110833349 13:80056867-80056889 CCTGCATCCCCATGTTTACCTTG No data
Right 1110833356 13:80056880-80056902 GTTTACCTTGGGGTTTCTAGAGG No data
1110833349_1110833363 19 Left 1110833349 13:80056867-80056889 CCTGCATCCCCATGTTTACCTTG No data
Right 1110833363 13:80056909-80056931 CTGGGATTCAGCCAGCTGTAGGG No data
1110833349_1110833362 18 Left 1110833349 13:80056867-80056889 CCTGCATCCCCATGTTTACCTTG No data
Right 1110833362 13:80056908-80056930 CCTGGGATTCAGCCAGCTGTAGG No data
1110833349_1110833358 0 Left 1110833349 13:80056867-80056889 CCTGCATCCCCATGTTTACCTTG No data
Right 1110833358 13:80056890-80056912 GGGTTTCTAGAGGTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110833349 Original CRISPR CAAGGTAAACATGGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr