ID: 1110833386

View in Genome Browser
Species Human (GRCh38)
Location 13:80057138-80057160
Sequence CTCATGTAGAAGTCTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110833380_1110833386 29 Left 1110833380 13:80057086-80057108 CCAGAAACAGACACTCCCAAACA No data
Right 1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG No data
1110833383_1110833386 13 Left 1110833383 13:80057102-80057124 CCAAACAGAGGCTTAAAAAATTA No data
Right 1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG No data
1110833382_1110833386 14 Left 1110833382 13:80057101-80057123 CCCAAACAGAGGCTTAAAAAATT No data
Right 1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110833386 Original CRISPR CTCATGTAGAAGTCTGGAGA TGG Intergenic
No off target data available for this crispr