ID: 1110833972

View in Genome Browser
Species Human (GRCh38)
Location 13:80063428-80063450
Sequence ACTCACTTCATAGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110833972_1110833978 20 Left 1110833972 13:80063428-80063450 CCTGTTTTGGCTATGAAGTGAGT No data
Right 1110833978 13:80063471-80063493 TATGTGGAATACCATGGTGGCGG No data
1110833972_1110833977 17 Left 1110833972 13:80063428-80063450 CCTGTTTTGGCTATGAAGTGAGT No data
Right 1110833977 13:80063468-80063490 TGCTATGTGGAATACCATGGTGG No data
1110833972_1110833979 26 Left 1110833972 13:80063428-80063450 CCTGTTTTGGCTATGAAGTGAGT No data
Right 1110833979 13:80063477-80063499 GAATACCATGGTGGCGGATAAGG No data
1110833972_1110833975 4 Left 1110833972 13:80063428-80063450 CCTGTTTTGGCTATGAAGTGAGT No data
Right 1110833975 13:80063455-80063477 TGGTCAGAAGCAATGCTATGTGG No data
1110833972_1110833976 14 Left 1110833972 13:80063428-80063450 CCTGTTTTGGCTATGAAGTGAGT No data
Right 1110833976 13:80063465-80063487 CAATGCTATGTGGAATACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110833972 Original CRISPR ACTCACTTCATAGCCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr