ID: 1110834037

View in Genome Browser
Species Human (GRCh38)
Location 13:80063834-80063856
Sequence TTGGGCAATGACGGGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110834019_1110834037 29 Left 1110834019 13:80063782-80063804 CCCATGTGTAACCTCCATCCCTG 0: 62
1: 127
2: 173
3: 180
4: 317
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834020_1110834037 28 Left 1110834020 13:80063783-80063805 CCATGTGTAACCTCCATCCCTGC 0: 64
1: 132
2: 179
3: 209
4: 422
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834025_1110834037 10 Left 1110834025 13:80063801-80063823 CCTGCCACCATGGTGACTTTGTT No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834023_1110834037 15 Left 1110834023 13:80063796-80063818 CCATCCCTGCCACCATGGTGACT No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834029_1110834037 3 Left 1110834029 13:80063808-80063830 CCATGGTGACTTTGTTCGTGGGC No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834026_1110834037 6 Left 1110834026 13:80063805-80063827 CCACCATGGTGACTTTGTTCGTG No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834024_1110834037 11 Left 1110834024 13:80063800-80063822 CCCTGCCACCATGGTGACTTTGT No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data
1110834022_1110834037 18 Left 1110834022 13:80063793-80063815 CCTCCATCCCTGCCACCATGGTG No data
Right 1110834037 13:80063834-80063856 TTGGGCAATGACGGGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110834037 Original CRISPR TTGGGCAATGACGGGTTGGC TGG Intergenic
No off target data available for this crispr