ID: 1110834138

View in Genome Browser
Species Human (GRCh38)
Location 13:80064656-80064678
Sequence TGTTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110834133_1110834138 16 Left 1110834133 13:80064617-80064639 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG No data
1110834136_1110834138 4 Left 1110834136 13:80064629-80064651 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG No data
1110834131_1110834138 25 Left 1110834131 13:80064608-80064630 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG No data
1110834132_1110834138 22 Left 1110834132 13:80064611-80064633 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG No data
1110834134_1110834138 15 Left 1110834134 13:80064618-80064640 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110834138 Original CRISPR TGTTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr