ID: 1110839780

View in Genome Browser
Species Human (GRCh38)
Location 13:80128612-80128634
Sequence GATCTAACTCAATAACTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110839778_1110839780 15 Left 1110839778 13:80128574-80128596 CCTGTAATAAAAACATGTATATA 0: 1
1: 0
2: 5
3: 92
4: 930
Right 1110839780 13:80128612-80128634 GATCTAACTCAATAACTGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110839780 Original CRISPR GATCTAACTCAATAACTGTA GGG Intergenic