ID: 1110839780 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:80128612-80128634 |
| Sequence | GATCTAACTCAATAACTGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 110 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 107} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1110839778_1110839780 | 15 | Left | 1110839778 | 13:80128574-80128596 | CCTGTAATAAAAACATGTATATA | 0: 1 1: 0 2: 5 3: 92 4: 930 |
||
| Right | 1110839780 | 13:80128612-80128634 | GATCTAACTCAATAACTGTAGGG | 0: 1 1: 0 2: 0 3: 2 4: 107 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1110839780 | Original CRISPR | GATCTAACTCAATAACTGTA GGG | Intergenic | ||