ID: 1110846140

View in Genome Browser
Species Human (GRCh38)
Location 13:80192428-80192450
Sequence TGGCAACCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110846140_1110846149 23 Left 1110846140 13:80192428-80192450 CCATCCACCACTGCTGGTTGCCA No data
Right 1110846149 13:80192474-80192496 TCCATCCCTCCGGATCTGGCAGG No data
1110846140_1110846148 19 Left 1110846140 13:80192428-80192450 CCATCCACCACTGCTGGTTGCCA No data
Right 1110846148 13:80192470-80192492 GACTTCCATCCCTCCGGATCTGG No data
1110846140_1110846146 13 Left 1110846140 13:80192428-80192450 CCATCCACCACTGCTGGTTGCCA No data
Right 1110846146 13:80192464-80192486 ACCGCTGACTTCCATCCCTCCGG 0: 10
1: 44
2: 108
3: 118
4: 166
1110846140_1110846151 24 Left 1110846140 13:80192428-80192450 CCATCCACCACTGCTGGTTGCCA No data
Right 1110846151 13:80192475-80192497 CCATCCCTCCGGATCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110846140 Original CRISPR TGGCAACCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr