ID: 1110848604

View in Genome Browser
Species Human (GRCh38)
Location 13:80218454-80218476
Sequence TGGCCCTCCACTGCAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110848604_1110848611 17 Left 1110848604 13:80218454-80218476 CCTCCCTCTGCAGTGGAGGGCCA No data
Right 1110848611 13:80218494-80218516 CTGCAGGTGAAGTCCGCCACTGG No data
1110848604_1110848609 1 Left 1110848604 13:80218454-80218476 CCTCCCTCTGCAGTGGAGGGCCA No data
Right 1110848609 13:80218478-80218500 GCTGCTTTCTGGTCCTCTGCAGG No data
1110848604_1110848607 -10 Left 1110848604 13:80218454-80218476 CCTCCCTCTGCAGTGGAGGGCCA No data
Right 1110848607 13:80218467-80218489 TGGAGGGCCAAGCTGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110848604 Original CRISPR TGGCCCTCCACTGCAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr