ID: 1110850689

View in Genome Browser
Species Human (GRCh38)
Location 13:80241413-80241435
Sequence CTTTGGGGCTCTGTAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110850689_1110850698 12 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850698 13:80241448-80241470 CCCTGGGTAAGAGAGCTTCTAGG No data
1110850689_1110850696 -4 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850696 13:80241432-80241454 AAAGAGGGTGTCACAGCCCTGGG No data
1110850689_1110850703 29 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850703 13:80241465-80241487 TCTAGGTCTGGGATCCCTGAGGG No data
1110850689_1110850700 17 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850700 13:80241453-80241475 GGTAAGAGAGCTTCTAGGTCTGG No data
1110850689_1110850701 18 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850701 13:80241454-80241476 GTAAGAGAGCTTCTAGGTCTGGG No data
1110850689_1110850702 28 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850702 13:80241464-80241486 TTCTAGGTCTGGGATCCCTGAGG No data
1110850689_1110850695 -5 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850695 13:80241431-80241453 CAAAGAGGGTGTCACAGCCCTGG 0: 95
1: 247
2: 266
3: 219
4: 316
1110850689_1110850704 30 Left 1110850689 13:80241413-80241435 CCAGGAGCTACAGAGCCCCAAAG No data
Right 1110850704 13:80241466-80241488 CTAGGTCTGGGATCCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110850689 Original CRISPR CTTTGGGGCTCTGTAGCTCC TGG (reversed) Intergenic
No off target data available for this crispr