ID: 1110858355

View in Genome Browser
Species Human (GRCh38)
Location 13:80321251-80321273
Sequence CCTGTTCAGGAGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110858355_1110858358 1 Left 1110858355 13:80321251-80321273 CCATTCACTGTCTCCTGAACAGG No data
Right 1110858358 13:80321275-80321297 TTTTGCTCGATCCTGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110858355 Original CRISPR CCTGTTCAGGAGACAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr